Detail view for rs1755609


Link to dbSNP entry

Link to Ensembl Variation entry

Sequence facts

chrpos (hg19)chrpos (hg38)ReferenceAlternate1000 Genomes Phase 1 FrequenciesSequence constraintdbSNP functional annotation
AFRAMRASNEURby GERPby SiPhy
chr96641917chr96641917GA0.440.370.530.23NoNointronic

Closest annotated gene
SourceDistanceDirectionID/LinkCommon nameDescription
GENCODENAWithin geneENSG00000178445.8GLDCglycine dehydrogenase (decarboxylating) [Source:HGNC Symbol;Acc:4313]
RefSeqNAWithin geneNM_000170GLDCglycine dehydrogenase (decarboxylating) [Source:HGNC Symbol;Acc:4313]

Regulatory chromatin states from DNAse and histone ChIP-Seq (Roadmap Epigenomics Consortium, 2015)

(Black = missing data)

Epigenome ID (EID)GroupMnemonicDescriptionChromatin states
(Core 15-state model)
Chromatin states
(25-state model
using 12 imputed marks)
H3K4me1H3K4me3H3K27acH3K9acDNase
E017IMR90LNG.IMR90IMR90 fetal lung fibroblasts Cell Line
E002ESCESC.WA7ES-WA7 Cells
E008ESCESC.H9H9 Cells
E001ESCESC.I3ES-I3 CellsH3K4me1_EnhH3K4me3_Pro
E015ESCESC.HUES6HUES6 CellsH3K4me1_Enh
E014ESCESC.HUES48HUES48 CellsH3K4me1_Enh
E016ESCESC.HUES64HUES64 CellsH3K4me1_Enh
E003ESCESC.H1H1 Cells
E024ESCESC.4STARES-UCSF4 Cells
E020iPSCIPSC.20BiPS-20b Cells6_EnhGH3K4me1_EnhH3K4me3_ProH3K27ac_Enh
E019iPSCIPSC.18iPS-18 Cells
E018iPSCIPSC.15biPS-15b CellsH3K9ac_Pro
E021iPSCIPSC.DF.6.9iPS DF 6.9 CellsDNase
E022iPSCIPSC.DF.19.11iPS DF 19.11 CellsH3K27ac_Enh
E007ES-derivESDR.H1.NEUR.PROGH1 Derived Neuronal Progenitor Cultured CellsH3K4me1_EnhH3K27ac_Enh
E009ES-derivESDR.H9.NEUR.PROGH9 Derived Neuronal Progenitor Cultured Cells12_TxEnhWH3K4me1_Enh
E010ES-derivESDR.H9.NEURH9 Derived Neuron Cultured Cells6_EnhGH3K4me1_Enh
E013ES-derivESDR.CD56.MESOhESC Derived CD56+ Mesoderm Cultured Cells
E012ES-derivESDR.CD56.ECTOhESC Derived CD56+ Ectoderm Cultured CellsH3K4me1_Enh
E011ES-derivESDR.CD184.ENDOhESC Derived CD184+ Endoderm Cultured Cells
E004ES-derivESDR.H1.BMP4.MESOH1 BMP4 Derived Mesendoderm Cultured Cells
E005ES-derivESDR.H1.BMP4.TROPH1 BMP4 Derived Trophoblast Cultured Cells
E006ES-derivESDR.H1.MSCH1 Derived Mesenchymal Stem Cells
E062Blood & T-cellBLD.PER.MONUC.PCPrimary mononuclear cells from peripheral blood
E034Blood & T-cellBLD.CD3.PPCPrimary T cells from peripheral blood
E045Blood & T-cellBLD.CD4.CD25I.CD127.TMEMPCPrimary T cells effector/memory enriched from peripheral blood
E033Blood & T-cellBLD.CD3.CPCPrimary T cells from cord blood
E044Blood & T-cellBLD.CD4.CD25.CD127M.TREGPCPrimary T regulatory cells from peripheral blood
E043Blood & T-cellBLD.CD4.CD25M.TPCPrimary T helper cells from peripheral blood
E039Blood & T-cellBLD.CD4.CD25M.CD45RA.NPCPrimary T helper naive cells from peripheral blood
E041Blood & T-cellBLD.CD4.CD25M.IL17M.PL.TPCPrimary T helper cells PMA-I stimulated
E042Blood & T-cellBLD.CD4.CD25M.IL17P.PL.TPCPrimary T helper 17 cells PMA-I stimulated
E040Blood & T-cellBLD.CD4.CD25M.CD45RO.MPCPrimary T helper memory cells from peripheral blood 1
E037Blood & T-cellBLD.CD4.MPCPrimary T helper memory cells from peripheral blood 2
E048Blood & T-cellBLD.CD8.MPCPrimary T CD8+ memory cells from peripheral blood
E038Blood & T-cellBLD.CD4.NPCPrimary T helper naive cells from peripheral bloodH3K27ac_Enh
E047Blood & T-cellBLD.CD8.NPCPrimary T CD8+ naive cells from peripheral blood
E029HSC & B-cellBLD.CD14.PCPrimary monocytes from peripheral blood
E031HSC & B-cellBLD.CD19.CPCPrimary B cells from cord blood
E035HSC & B-cellBLD.CD34.PCPrimary hematopoietic stem cells
E051HSC & B-cellBLD.MOB.CD34.PC.MPrimary hematopoietic stem cells G-CSF-mobilized Male
E050HSC & B-cellBLD.MOB.CD34.PC.FPrimary hematopoietic stem cells G-CSF-mobilized Female
E036HSC & B-cellBLD.CD34.CCPrimary hematopoietic stem cells short term culture
E032HSC & B-cellBLD.CD19.PPCPrimary B cells from peripheral blood
E046HSC & B-cellBLD.CD56.PCPrimary Natural Killer cells from peripheral blood
E030HSC & B-cellBLD.CD15.PCPrimary neutrophils from peripheral blood
E026MesenchSTRM.MRW.MSCBone Marrow Derived Cultured Mesenchymal Stem Cells
E049MesenchSTRM.CHON.MRW.DR.MSCMesenchymal Stem Cell Derived Chondrocyte Cultured Cells
E025MesenchFAT.ADIP.DR.MSCAdipose Derived Mesenchymal Stem Cell Cultured Cells
E023MesenchFAT.MSC.DR.ADIPMesenchymal Stem Cell Derived Adipocyte Cultured Cells
E052MyosatMUS.SATMuscle Satellite Cultured Cells
E055EpithelialSKIN.PEN.FRSK.FIB.01Foreskin Fibroblast Primary Cells skin01
E056EpithelialSKIN.PEN.FRSK.FIB.02Foreskin Fibroblast Primary Cells skin02
E059EpithelialSKIN.PEN.FRSK.MEL.01Foreskin Melanocyte Primary Cells skin01
E061EpithelialSKIN.PEN.FRSK.MEL.03Foreskin Melanocyte Primary Cells skin03
E057EpithelialSKIN.PEN.FRSK.KER.02Foreskin Keratinocyte Primary Cells skin02DNase
E058EpithelialSKIN.PEN.FRSK.KER.03Foreskin Keratinocyte Primary Cells skin0319_DNaseH3K4me1_Enh
E028EpithelialBRST.HMEC.35Breast variant Human Mammary Epithelial Cells (vHMEC)
E027EpithelialBRST.MYOBreast Myoepithelial Primary Cells
E054NeurosphBRN.GANGEM.DR.NRSPHRGanglion Eminence derived primary cultured neurospheres7_EnhH3K4me1_EnhH3K4me3_Pro
E053NeurosphBRN.CRTX.DR.NRSPHRCortex derived primary cultured neurospheres7_EnhH3K4me1_Enh
E112ThymusTHYMThymus
E093ThymusTHYM.FETFetal Thymus
E071BrainBRN.HIPP.MIDBrain Hippocampus MiddleH3K4me1_Enh
E074BrainBRN.SUB.NIGBrain Substantia Nigra
E068BrainBRN.ANT.CAUDBrain Anterior CaudateH3K4me1_Enh
E069BrainBRN.CING.GYRBrain Cingulate GyrusH3K4me1_Enh
E072BrainBRN.INF.TMPBrain Inferior Temporal LobeH3K27ac_Enh
E067BrainBRN.ANG.GYRBrain Angular Gyrus
E073BrainBRN.DL.PRFRNTL.CRTXBrain_Dorsolateral_Prefrontal_CortexH3K27ac_Enh
E070BrainBRN.GRM.MTRXBrain Germinal Matrix
E082BrainBRN.FET.FFetal Brain FemaleH3K4me1_Enh
E081BrainBRN.FET.MFetal Brain Male
E063AdiposeFAT.ADIP.NUCAdipose Nuclei
E100MuscleMUS.PSOASPsoas Muscle
E108MuscleMUS.SKLT.FSkeletal Muscle Female
E107MuscleMUS.SKLT.MSkeletal Muscle Male
E089MuscleMUS.TRNK.FETFetal Muscle Trunk
E090MuscleMUS.LEG.FETFetal Muscle Leg
E083HeartHRT.FETFetal Heart
E104HeartHRT.ATR.RRight Atrium
E095HeartHRT.VENT.LLeft Ventricle
E105HeartHRT.VNT.RRight Ventricle
E065HeartVAS.AORAorta
E078Sm. MuscleGI.DUO.SM.MUSDuodenum Smooth Muscle
E076Sm. MuscleGI.CLN.SM.MUSColon Smooth Muscle
E103Sm. MuscleGI.RECT.SM.MUSRectal Smooth Muscle
E111Sm. MuscleGI.STMC.MUSStomach Smooth Muscle
E092DigestiveGI.STMC.FETFetal Stomach
E085DigestiveGI.S.INT.FETFetal Intestine SmallH3K4me1_Enh
E084DigestiveGI.L.INT.FETFetal Intestine Large7_EnhH3K4me1_Enh
E109DigestiveGI.S.INTSmall IntestineH3K27ac_Enh
E106DigestiveGI.CLN.SIGSigmoid Colon
E075DigestiveGI.CLN.MUCColonic MucosaH3K27ac_Enh
E101DigestiveGI.RECT.MUC.29Rectal Mucosa Donor 29H3K9ac_Pro
E102DigestiveGI.RECT.MUC.31Rectal Mucosa Donor 31
E110DigestiveGI.STMC.MUCStomach MucosaH3K4me3_Pro
E077DigestiveGI.DUO.MUCDuodenum MucosaH3K4me1_Enh
E079DigestiveGI.ESOEsophagusH3K4me1_Enh
E094DigestiveGI.STMC.GASTGastric
E099OtherPLCNT.AMNPlacenta Amnion
E086OtherKID.FETFetal KidneyH3K4me1_Enh
E088OtherLNG.FETFetal Lung
E097OtherOVRYOvary
E087OtherPANC.ISLTPancreatic Islets
E080OtherADRL.GLND.FETFetal Adrenal Gland
E091OtherPLCNT.FETPlacenta7_EnhH3K4me1_EnhH3K27ac_EnhDNase
E066OtherLIV.ADLTLiver6_EnhG12_TxEnhWH3K4me1_EnhH3K4me3_ProH3K27ac_Enh
E098OtherPANCPancreas
E096OtherLNGLung
E113OtherSPLNSpleen
E114ENCODE2012LNG.A549.ETOH002.CNCRA549 EtOH 0.02pct Lung Carcinoma Cell Line7_EnhH3K4me1_Enh
E115ENCODE2012BLD.DND41.CNCRDnd41 TCell Leukemia Cell Line
E116ENCODE2012BLD.GM12878GM12878 Lymphoblastoid Cells1_TssAH3K4me1_EnhH3K4me3_Pro
E117ENCODE2012CRVX.HELAS3.CNCRHeLa-S3 Cervical Carcinoma Cell Line
E118ENCODE2012LIV.HEPG2.CNCRHepG2 Hepatocellular Carcinoma Cell Line6_EnhGH3K4me1_EnhH3K27ac_Enh
E119ENCODE2012BRST.HMECHMEC Mammary Epithelial Primary Cells
E120ENCODE2012MUS.HSMMHSMM Skeletal Muscle Myoblasts Cells
E121ENCODE2012MUS.HSMMTHSMM cell derived Skeletal Muscle Myotubes Cells
E122ENCODE2012VAS.HUVECHUVEC Umbilical Vein Endothelial Primary Cells
E123ENCODE2012BLD.K562.CNCRK562 Leukemia Cells
E124ENCODE2012BLD.CD14.MONOMonocytes-CD14+ RO01746 Primary Cells
E125ENCODE2012BRN.NHANH-A Astrocytes Primary Cells
E126ENCODE2012SKIN.NHDFADNHDF-Ad Adult Dermal Fibroblast Primary Cells
E127ENCODE2012SKIN.NHEKNHEK-Epidermal Keratinocyte Primary Cells19_DNaseH3K4me1_Enh
E128ENCODE2012LNG.NHLFNHLF Lung Fibroblast Primary Cells
E129ENCODE2012BONE.OSTEOOsteoblast Primary Cells

Proteins bound in ChIP-Seq experiments (ENCODE Project Consortium, 2011)

Cell IDProtein
T-47DGATA3

GRASP QTL hits

Traitp-valuePMID
Gene expression of GLDC in peripheral blood monocytes5.55E-0920502693

Hits from selected eQTL studies

Study IDPaper TitlePMIDTissueCorrelated genep-value
GTEx2015_v6The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans25954001Esophagus_Gastroesophageal_JunctionGLDC1.14386931581655e-22
GTEx2015_v6The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans25954001Esophagus_MuscularisGLDC4.80183979129028e-38
Lappalainen2013Transcriptome and genome sequencing uncovers functional variation in humans24037378Lymphoblastoid_EUR_exonlevelENSG00000178445.8_6540051_65401462.84634009715566e-06
Lappalainen2013Transcriptome and genome sequencing uncovers functional variation in humans24037378Lymphoblastoid_EUR_exonlevelENSG00000178445.8_6610192_66103561.06931390004397e-06
Westra2013Systematic identification of trans eQTLs as putative drivers of known disease associations24013639Whole_BloodGLDC2.68897757257952E-26

Regulatory motifs altered

Position Weight Matrix ID
(Library from Kheradpour and Kellis, 2013)
StrandRefAltMatch on:
Ref: CTACACTAGAACACAGGCATTCACATGAAGCCAAGTTTGAGTAATGGTGCTCCACTATT
Alt: CTACACTAGAACACAGGCATTCACATGAAACCAAGTTTGAGTAATGGTGCTCCACTATT
DEC-12.72
                      NVHKCASDTGVVB