Link to Ensembl Variation entry
Sequence facts
chr | pos (hg19) | chr | pos (hg38) | Reference | Alternate | 1000 Genomes Phase 1 Frequencies | Sequence constraint | dbSNP functional annotation | ||||
AFR | AMR | ASN | EUR | by GERP | by SiPhy | |||||||
chr1 | 23410742 | chr1 | 23084249 | A | C | 0.83 | 0.64 | 0.79 | 0.83 | No | No | 3'-UTR |
Closest annotated gene | |||||
Source | Distance | Direction | ID/Link | Common name | Description |
GENCODE | NA | Within gene | ENSG00000240553.1 | RP1-184J9.2 | |
RefSeq | NA | Within gene | NM_001142546 | LUZP1 | leucine zipper protein 1 [Source:HGNC Symbol;Acc:14985] |
Regulatory chromatin states from DNAse and histone ChIP-Seq (Roadmap Epigenomics Consortium, 2015)
Epigenome ID (EID) | Group | Mnemonic | Description | Chromatin states (Core 15-state model) | Chromatin states (25-state model using 12 imputed marks) | H3K4me1 | H3K4me3 | H3K27ac | H3K9ac | DNase |
E001 | ESC | ESC.I3 | ES-I3 Cells | |||||||
E002 | ESC | ESC.WA7 | ES-WA7 Cells | |||||||
E003 | ESC | ESC.H1 | H1 Cells | H3K27ac_Enh | ||||||
E004 | ES-deriv | ESDR.H1.BMP4.MESO | H1 BMP4 Derived Mesendoderm Cultured Cells | |||||||
E005 | ES-deriv | ESDR.H1.BMP4.TROP | H1 BMP4 Derived Trophoblast Cultured Cells | |||||||
E006 | ES-deriv | ESDR.H1.MSC | H1 Derived Mesenchymal Stem Cells | H3K9ac_Pro | ||||||
E007 | ES-deriv | ESDR.H1.NEUR.PROG | H1 Derived Neuronal Progenitor Cultured Cells | |||||||
E008 | ESC | ESC.H9 | H9 Cells | H3K27ac_Enh | H3K9ac_Pro | |||||
E009 | ES-deriv | ESDR.H9.NEUR.PROG | H9 Derived Neuronal Progenitor Cultured Cells | |||||||
E010 | ES-deriv | ESDR.H9.NEUR | H9 Derived Neuron Cultured Cells | |||||||
E011 | ES-deriv | ESDR.CD184.ENDO | hESC Derived CD184+ Endoderm Cultured Cells | H3K27ac_Enh | ||||||
E012 | ES-deriv | ESDR.CD56.ECTO | hESC Derived CD56+ Ectoderm Cultured Cells | H3K27ac_Enh | ||||||
E013 | ES-deriv | ESDR.CD56.MESO | hESC Derived CD56+ Mesoderm Cultured Cells | H3K27ac_Enh | ||||||
E014 | ESC | ESC.HUES48 | HUES48 Cells | H3K27ac_Enh | ||||||
E015 | ESC | ESC.HUES6 | HUES6 Cells | |||||||
E016 | ESC | ESC.HUES64 | HUES64 Cells | |||||||
E017 | IMR90 | LNG.IMR90 | IMR90 fetal lung fibroblasts Cell Line | |||||||
E018 | iPSC | IPSC.15b | iPS-15b Cells | |||||||
E019 | iPSC | IPSC.18 | iPS-18 Cells | |||||||
E020 | iPSC | IPSC.20B | iPS-20b Cells | |||||||
E021 | iPSC | IPSC.DF.6.9 | iPS DF 6.9 Cells | |||||||
E022 | iPSC | IPSC.DF.19.11 | iPS DF 19.11 Cells | |||||||
E023 | Mesench | FAT.MSC.DR.ADIP | Mesenchymal Stem Cell Derived Adipocyte Cultured Cells | 6_EnhG | 10_TxEnh5 | H3K4me1_Enh | H3K9ac_Pro | |||
E024 | ESC | ESC.4STAR | ES-UCSF4 Cells | |||||||
E025 | Mesench | FAT.ADIP.DR.MSC | Adipose Derived Mesenchymal Stem Cell Cultured Cells | 11_TxEnh3 | H3K4me1_Enh | |||||
E026 | Mesench | STRM.MRW.MSC | Bone Marrow Derived Cultured Mesenchymal Stem Cells | H3K4me1_Enh | ||||||
E027 | Epithelial | BRST.MYO | Breast Myoepithelial Primary Cells | 6_EnhG | 11_TxEnh3 | H3K4me1_Enh | H3K9ac_Pro | |||
E028 | Epithelial | BRST.HMEC.35 | Breast variant Human Mammary Epithelial Cells (vHMEC) | |||||||
E029 | HSC & B-cell | BLD.CD14.PC | Primary monocytes from peripheral blood | |||||||
E030 | HSC & B-cell | BLD.CD15.PC | Primary neutrophils from peripheral blood | |||||||
E031 | HSC & B-cell | BLD.CD19.CPC | Primary B cells from cord blood | |||||||
E032 | HSC & B-cell | BLD.CD19.PPC | Primary B cells from peripheral blood | |||||||
E033 | Blood & T-cell | BLD.CD3.CPC | Primary T cells from cord blood | |||||||
E034 | Blood & T-cell | BLD.CD3.PPC | Primary T cells from peripheral blood | |||||||
E035 | HSC & B-cell | BLD.CD34.PC | Primary hematopoietic stem cells | |||||||
E036 | HSC & B-cell | BLD.CD34.CC | Primary hematopoietic stem cells short term culture | |||||||
E037 | Blood & T-cell | BLD.CD4.MPC | Primary T helper memory cells from peripheral blood 2 | |||||||
E038 | Blood & T-cell | BLD.CD4.NPC | Primary T helper naive cells from peripheral blood | H3K9ac_Pro | ||||||
E039 | Blood & T-cell | BLD.CD4.CD25M.CD45RA.NPC | Primary T helper naive cells from peripheral blood | |||||||
E040 | Blood & T-cell | BLD.CD4.CD25M.CD45RO.MPC | Primary T helper memory cells from peripheral blood 1 | |||||||
E041 | Blood & T-cell | BLD.CD4.CD25M.IL17M.PL.TPC | Primary T helper cells PMA-I stimulated | H3K27ac_Enh | ||||||
E042 | Blood & T-cell | BLD.CD4.CD25M.IL17P.PL.TPC | Primary T helper 17 cells PMA-I stimulated | |||||||
E043 | Blood & T-cell | BLD.CD4.CD25M.TPC | Primary T helper cells from peripheral blood | |||||||
E044 | Blood & T-cell | BLD.CD4.CD25.CD127M.TREGPC | Primary T regulatory cells from peripheral blood | |||||||
E045 | Blood & T-cell | BLD.CD4.CD25I.CD127.TMEMPC | Primary T cells effector/memory enriched from peripheral blood | |||||||
E046 | HSC & B-cell | BLD.CD56.PC | Primary Natural Killer cells from peripheral blood | |||||||
E047 | Blood & T-cell | BLD.CD8.NPC | Primary T CD8+ naive cells from peripheral blood | |||||||
E048 | Blood & T-cell | BLD.CD8.MPC | Primary T CD8+ memory cells from peripheral blood | |||||||
E049 | Mesench | STRM.CHON.MRW.DR.MSC | Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells | 11_TxEnh3 | H3K4me1_Enh | H3K27ac_Enh | ||||
E050 | HSC & B-cell | BLD.MOB.CD34.PC.F | Primary hematopoietic stem cells G-CSF-mobilized Female | H3K27ac_Enh | ||||||
E051 | HSC & B-cell | BLD.MOB.CD34.PC.M | Primary hematopoietic stem cells G-CSF-mobilized Male | |||||||
E052 | Myosat | MUS.SAT | Muscle Satellite Cultured Cells | 11_TxEnh3 | ||||||
E053 | Neurosph | BRN.CRTX.DR.NRSPHR | Cortex derived primary cultured neurospheres | |||||||
E054 | Neurosph | BRN.GANGEM.DR.NRSPHR | Ganglion Eminence derived primary cultured neurospheres | |||||||
E055 | Epithelial | SKIN.PEN.FRSK.FIB.01 | Foreskin Fibroblast Primary Cells skin01 | |||||||
E056 | Epithelial | SKIN.PEN.FRSK.FIB.02 | Foreskin Fibroblast Primary Cells skin02 | H3K27ac_Enh | ||||||
E057 | Epithelial | SKIN.PEN.FRSK.KER.02 | Foreskin Keratinocyte Primary Cells skin02 | |||||||
E058 | Epithelial | SKIN.PEN.FRSK.KER.03 | Foreskin Keratinocyte Primary Cells skin03 | |||||||
E059 | Epithelial | SKIN.PEN.FRSK.MEL.01 | Foreskin Melanocyte Primary Cells skin01 | |||||||
E061 | Epithelial | SKIN.PEN.FRSK.MEL.03 | Foreskin Melanocyte Primary Cells skin03 | |||||||
E062 | Blood & T-cell | BLD.PER.MONUC.PC | Primary mononuclear cells from peripheral blood | |||||||
E063 | Adipose | FAT.ADIP.NUC | Adipose Nuclei | 6_EnhG | 11_TxEnh3 | H3K4me1_Enh | ||||
E065 | Heart | VAS.AOR | Aorta | |||||||
E066 | Other | LIV.ADLT | Liver | 6_EnhG | H3K4me1_Enh | |||||
E067 | Brain | BRN.ANG.GYR | Brain Angular Gyrus | 11_TxEnh3 | H3K4me1_Enh | H3K27ac_Enh | H3K9ac_Pro | |||
E068 | Brain | BRN.ANT.CAUD | Brain Anterior Caudate | 6_EnhG | 11_TxEnh3 | H3K4me1_Enh | H3K27ac_Enh | |||
E069 | Brain | BRN.CING.GYR | Brain Cingulate Gyrus | 6_EnhG | 11_TxEnh3 | H3K4me1_Enh | H3K27ac_Enh | |||
E070 | Brain | BRN.GRM.MTRX | Brain Germinal Matrix | |||||||
E071 | Brain | BRN.HIPP.MID | Brain Hippocampus Middle | 6_EnhG | 11_TxEnh3 | H3K4me1_Enh | H3K27ac_Enh | |||
E072 | Brain | BRN.INF.TMP | Brain Inferior Temporal Lobe | 11_TxEnh3 | H3K4me1_Enh | H3K27ac_Enh | H3K9ac_Pro | |||
E073 | Brain | BRN.DL.PRFRNTL.CRTX | Brain_Dorsolateral_Prefrontal_Cortex | 11_TxEnh3 | H3K4me1_Enh | H3K27ac_Enh | H3K9ac_Pro | |||
E074 | Brain | BRN.SUB.NIG | Brain Substantia Nigra | 11_TxEnh3 | H3K4me1_Enh | |||||
E075 | Digestive | GI.CLN.MUC | Colonic Mucosa | |||||||
E076 | Sm. Muscle | GI.CLN.SM.MUS | Colon Smooth Muscle | |||||||
E077 | Digestive | GI.DUO.MUC | Duodenum Mucosa | |||||||
E078 | Sm. Muscle | GI.DUO.SM.MUS | Duodenum Smooth Muscle | 11_TxEnh3 | ||||||
E079 | Digestive | GI.ESO | Esophagus | |||||||
E080 | Other | ADRL.GLND.FET | Fetal Adrenal Gland | 6_EnhG | H3K4me1_Enh | |||||
E081 | Brain | BRN.FET.M | Fetal Brain Male | DNase | ||||||
E082 | Brain | BRN.FET.F | Fetal Brain Female | H3K4me1_Enh | ||||||
E083 | Heart | HRT.FET | Fetal Heart | |||||||
E084 | Digestive | GI.L.INT.FET | Fetal Intestine Large | |||||||
E085 | Digestive | GI.S.INT.FET | Fetal Intestine Small | |||||||
E086 | Other | KID.FET | Fetal Kidney | |||||||
E087 | Other | PANC.ISLT | Pancreatic Islets | |||||||
E088 | Other | LNG.FET | Fetal Lung | H3K4me1_Enh | H3K9ac_Pro | |||||
E089 | Muscle | MUS.TRNK.FET | Fetal Muscle Trunk | |||||||
E090 | Muscle | MUS.LEG.FET | Fetal Muscle Leg | |||||||
E091 | Other | PLCNT.FET | Placenta | |||||||
E092 | Digestive | GI.STMC.FET | Fetal Stomach | |||||||
E093 | Thymus | THYM.FET | Fetal Thymus | |||||||
E094 | Digestive | GI.STMC.GAST | Gastric | H3K4me1_Enh | ||||||
E095 | Heart | HRT.VENT.L | Left Ventricle | H3K4me1_Enh | H3K27ac_Enh | |||||
E096 | Other | LNG | Lung | H3K4me1_Enh | ||||||
E097 | Other | OVRY | Ovary | H3K4me1_Enh | H3K27ac_Enh | |||||
E098 | Other | PANC | Pancreas | |||||||
E099 | Other | PLCNT.AMN | Placenta Amnion | |||||||
E100 | Muscle | MUS.PSOAS | Psoas Muscle | |||||||
E101 | Digestive | GI.RECT.MUC.29 | Rectal Mucosa Donor 29 | |||||||
E102 | Digestive | GI.RECT.MUC.31 | Rectal Mucosa Donor 31 | H3K4me1_Enh | ||||||
E103 | Sm. Muscle | GI.RECT.SM.MUS | Rectal Smooth Muscle | |||||||
E104 | Heart | HRT.ATR.R | Right Atrium | 7_Enh | ||||||
E105 | Heart | HRT.VNT.R | Right Ventricle | H3K4me1_Enh | ||||||
E106 | Digestive | GI.CLN.SIG | Sigmoid Colon | |||||||
E107 | Muscle | MUS.SKLT.M | Skeletal Muscle Male | 11_TxEnh3 | ||||||
E108 | Muscle | MUS.SKLT.F | Skeletal Muscle Female | 11_TxEnh3 | H3K4me1_Enh | |||||
E109 | Digestive | GI.S.INT | Small Intestine | |||||||
E110 | Digestive | GI.STMC.MUC | Stomach Mucosa | |||||||
E111 | Sm. Muscle | GI.STMC.MUS | Stomach Smooth Muscle | 11_TxEnh3 | ||||||
E112 | Thymus | THYM | Thymus | |||||||
E113 | Other | SPLN | Spleen | H3K4me1_Enh | ||||||
E114 | ENCODE2012 | LNG.A549.ETOH002.CNCR | A549 EtOH 0.02pct Lung Carcinoma Cell Line | |||||||
E115 | ENCODE2012 | BLD.DND41.CNCR | Dnd41 TCell Leukemia Cell Line | |||||||
E116 | ENCODE2012 | BLD.GM12878 | GM12878 Lymphoblastoid Cells | |||||||
E117 | ENCODE2012 | CRVX.HELAS3.CNCR | HeLa-S3 Cervical Carcinoma Cell Line | |||||||
E118 | ENCODE2012 | LIV.HEPG2.CNCR | HepG2 Hepatocellular Carcinoma Cell Line | |||||||
E119 | ENCODE2012 | BRST.HMEC | HMEC Mammary Epithelial Primary Cells | |||||||
E120 | ENCODE2012 | MUS.HSMM | HSMM Skeletal Muscle Myoblasts Cells | |||||||
E121 | ENCODE2012 | MUS.HSMMT | HSMM cell derived Skeletal Muscle Myotubes Cells | |||||||
E122 | ENCODE2012 | VAS.HUVEC | HUVEC Umbilical Vein Endothelial Primary Cells | 6_EnhG | H3K4me1_Enh | |||||
E123 | ENCODE2012 | BLD.K562.CNCR | K562 Leukemia Cells | |||||||
E124 | ENCODE2012 | BLD.CD14.MONO | Monocytes-CD14+ RO01746 Primary Cells | H3K27ac_Enh | H3K9ac_Pro | |||||
E125 | ENCODE2012 | BRN.NHA | NH-A Astrocytes Primary Cells | |||||||
E126 | ENCODE2012 | SKIN.NHDFAD | NHDF-Ad Adult Dermal Fibroblast Primary Cells | |||||||
E127 | ENCODE2012 | SKIN.NHEK | NHEK-Epidermal Keratinocyte Primary Cells | |||||||
E128 | ENCODE2012 | LNG.NHLF | NHLF Lung Fibroblast Primary Cells | |||||||
E129 | ENCODE2012 | BONE.OSTEO | Osteoblast Primary Cells | 11_TxEnh3 | H3K27ac_Enh |
Proteins bound in ChIP-Seq experiments (ENCODE Project Consortium, 2011)
Cell ID | Protein |
H1-hESC | POL2 |
H1-hESC | POL2 |
Hits from selected eQTL studies
Study ID | Paper Title | PMID | Tissue | Correlated gene | p-value |
GTEx2015_v6 | The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans | 25954001 | Testis | LACTBL1 | 4.42659297243083e-11 |
Regulatory motifs altered
Position Weight Matrix ID (Library from Kheradpour and Kellis, 2013) | Strand | Ref | Alt | Match on:Ref: GTTCTGGAAGCTTAAAGTCTAAAATGGGTACACAGGGCTGCATTCATTACAGAGGCTCT |
AIRE_1 | + | 10.9 | 8.9 | WHWDDWHHWGGWWNDWWHGGWBDHWW |
HNF4_disc5 | - | -34.1 | -22.2 | GYCCWKTGT |
Rad21_disc8 | - | 0.4 | 11.6 | SNSSNSNKSSCDSS |