Detail view for rs506004

Link to dbSNP entry

Link to Ensembl Variation entry
Sequence facts
chr pos (hg19) chr pos (hg38) Reference Alternate 1000 Genomes Phase 1 Frequencies Sequence constraint dbSNP functional annotation
AFR AMR ASN EUR by GERP by SiPhy
chr1 23410742 chr1 23084249 A C 0.83 0.64 0.79 0.83 No No 3'-UTR
Closest annotated gene
Source Distance Direction ID/Link Common name Description
GENCODE NA Within gene ENSG00000240553.1 RP1-184J9.2
RefSeq NA Within gene NM_001142546 LUZP1 leucine zipper protein 1 [Source:HGNC Symbol;Acc:14985]
Regulatory chromatin states from DNAse and histone ChIP-Seq (Roadmap Epigenomics Consortium, 2015)

(Black = missing data)

Epigenome ID (EID)	Group	Mnemonic	Description	Chromatin states (Core 15-state model)	Chromatin states (25-state model using 12 imputed marks)	H3K4me1	H3K4me3	H3K27ac	H3K9ac	DNase
E001	ESC	ESC.I3	ES-I3 Cells
E002	ESC	ESC.WA7	ES-WA7 Cells
E003	ESC	ESC.H1	H1 Cells					H3K27ac_Enh
E004	ES-deriv	ESDR.H1.BMP4.MESO	H1 BMP4 Derived Mesendoderm Cultured Cells
E005	ES-deriv	ESDR.H1.BMP4.TROP	H1 BMP4 Derived Trophoblast Cultured Cells
E006	ES-deriv	ESDR.H1.MSC	H1 Derived Mesenchymal Stem Cells						H3K9ac_Pro
E007	ES-deriv	ESDR.H1.NEUR.PROG	H1 Derived Neuronal Progenitor Cultured Cells
E008	ESC	ESC.H9	H9 Cells					H3K27ac_Enh	H3K9ac_Pro
E009	ES-deriv	ESDR.H9.NEUR.PROG	H9 Derived Neuronal Progenitor Cultured Cells
E010	ES-deriv	ESDR.H9.NEUR	H9 Derived Neuron Cultured Cells
E011	ES-deriv	ESDR.CD184.ENDO	hESC Derived CD184+ Endoderm Cultured Cells					H3K27ac_Enh
E012	ES-deriv	ESDR.CD56.ECTO	hESC Derived CD56+ Ectoderm Cultured Cells					H3K27ac_Enh
E013	ES-deriv	ESDR.CD56.MESO	hESC Derived CD56+ Mesoderm Cultured Cells					H3K27ac_Enh
E014	ESC	ESC.HUES48	HUES48 Cells					H3K27ac_Enh
E015	ESC	ESC.HUES6	HUES6 Cells
E016	ESC	ESC.HUES64	HUES64 Cells
E017	IMR90	LNG.IMR90	IMR90 fetal lung fibroblasts Cell Line
E018	iPSC	IPSC.15b	iPS-15b Cells
E019	iPSC	IPSC.18	iPS-18 Cells
E020	iPSC	IPSC.20B	iPS-20b Cells
E021	iPSC	IPSC.DF.6.9	iPS DF 6.9 Cells
E022	iPSC	IPSC.DF.19.11	iPS DF 19.11 Cells
E023	Mesench	FAT.MSC.DR.ADIP	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	6_EnhG	10_TxEnh5	H3K4me1_Enh			H3K9ac_Pro
E024	ESC	ESC.4STAR	ES-UCSF4 Cells
E025	Mesench	FAT.ADIP.DR.MSC	Adipose Derived Mesenchymal Stem Cell Cultured Cells		11_TxEnh3	H3K4me1_Enh
E026	Mesench	STRM.MRW.MSC	Bone Marrow Derived Cultured Mesenchymal Stem Cells			H3K4me1_Enh
E027	Epithelial	BRST.MYO	Breast Myoepithelial Primary Cells	6_EnhG	11_TxEnh3	H3K4me1_Enh			H3K9ac_Pro
E028	Epithelial	BRST.HMEC.35	Breast variant Human Mammary Epithelial Cells (vHMEC)
E029	HSC & B-cell	BLD.CD14.PC	Primary monocytes from peripheral blood
E030	HSC & B-cell	BLD.CD15.PC	Primary neutrophils from peripheral blood
E031	HSC & B-cell	BLD.CD19.CPC	Primary B cells from cord blood
E032	HSC & B-cell	BLD.CD19.PPC	Primary B cells from peripheral blood
E033	Blood & T-cell	BLD.CD3.CPC	Primary T cells from cord blood
E034	Blood & T-cell	BLD.CD3.PPC	Primary T cells from peripheral blood
E035	HSC & B-cell	BLD.CD34.PC	Primary hematopoietic stem cells
E036	HSC & B-cell	BLD.CD34.CC	Primary hematopoietic stem cells short term culture
E037	Blood & T-cell	BLD.CD4.MPC	Primary T helper memory cells from peripheral blood 2
E038	Blood & T-cell	BLD.CD4.NPC	Primary T helper naive cells from peripheral blood						H3K9ac_Pro
E039	Blood & T-cell	BLD.CD4.CD25M.CD45RA.NPC	Primary T helper naive cells from peripheral blood
E040	Blood & T-cell	BLD.CD4.CD25M.CD45RO.MPC	Primary T helper memory cells from peripheral blood 1
E041	Blood & T-cell	BLD.CD4.CD25M.IL17M.PL.TPC	Primary T helper cells PMA-I stimulated					H3K27ac_Enh
E042	Blood & T-cell	BLD.CD4.CD25M.IL17P.PL.TPC	Primary T helper 17 cells PMA-I stimulated
E043	Blood & T-cell	BLD.CD4.CD25M.TPC	Primary T helper cells from peripheral blood
E044	Blood & T-cell	BLD.CD4.CD25.CD127M.TREGPC	Primary T regulatory cells from peripheral blood
E045	Blood & T-cell	BLD.CD4.CD25I.CD127.TMEMPC	Primary T cells effector/memory enriched from peripheral blood
E046	HSC & B-cell	BLD.CD56.PC	Primary Natural Killer cells from peripheral blood
E047	Blood & T-cell	BLD.CD8.NPC	Primary T CD8+ naive cells from peripheral blood
E048	Blood & T-cell	BLD.CD8.MPC	Primary T CD8+ memory cells from peripheral blood
E049	Mesench	STRM.CHON.MRW.DR.MSC	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells		11_TxEnh3	H3K4me1_Enh		H3K27ac_Enh
E050	HSC & B-cell	BLD.MOB.CD34.PC.F	Primary hematopoietic stem cells G-CSF-mobilized Female					H3K27ac_Enh
E051	HSC & B-cell	BLD.MOB.CD34.PC.M	Primary hematopoietic stem cells G-CSF-mobilized Male
E052	Myosat	MUS.SAT	Muscle Satellite Cultured Cells		11_TxEnh3
E053	Neurosph	BRN.CRTX.DR.NRSPHR	Cortex derived primary cultured neurospheres
E054	Neurosph	BRN.GANGEM.DR.NRSPHR	Ganglion Eminence derived primary cultured neurospheres
E055	Epithelial	SKIN.PEN.FRSK.FIB.01	Foreskin Fibroblast Primary Cells skin01
E056	Epithelial	SKIN.PEN.FRSK.FIB.02	Foreskin Fibroblast Primary Cells skin02					H3K27ac_Enh
E057	Epithelial	SKIN.PEN.FRSK.KER.02	Foreskin Keratinocyte Primary Cells skin02
E058	Epithelial	SKIN.PEN.FRSK.KER.03	Foreskin Keratinocyte Primary Cells skin03
E059	Epithelial	SKIN.PEN.FRSK.MEL.01	Foreskin Melanocyte Primary Cells skin01
E061	Epithelial	SKIN.PEN.FRSK.MEL.03	Foreskin Melanocyte Primary Cells skin03
E062	Blood & T-cell	BLD.PER.MONUC.PC	Primary mononuclear cells from peripheral blood
E063	Adipose	FAT.ADIP.NUC	Adipose Nuclei	6_EnhG	11_TxEnh3	H3K4me1_Enh
E065	Heart	VAS.AOR	Aorta
E066	Other	LIV.ADLT	Liver	6_EnhG		H3K4me1_Enh
E067	Brain	BRN.ANG.GYR	Brain Angular Gyrus		11_TxEnh3	H3K4me1_Enh		H3K27ac_Enh	H3K9ac_Pro
E068	Brain	BRN.ANT.CAUD	Brain Anterior Caudate	6_EnhG	11_TxEnh3	H3K4me1_Enh		H3K27ac_Enh
E069	Brain	BRN.CING.GYR	Brain Cingulate Gyrus	6_EnhG	11_TxEnh3	H3K4me1_Enh		H3K27ac_Enh
E070	Brain	BRN.GRM.MTRX	Brain Germinal Matrix
E071	Brain	BRN.HIPP.MID	Brain Hippocampus Middle	6_EnhG	11_TxEnh3	H3K4me1_Enh		H3K27ac_Enh
E072	Brain	BRN.INF.TMP	Brain Inferior Temporal Lobe		11_TxEnh3	H3K4me1_Enh		H3K27ac_Enh	H3K9ac_Pro
E073	Brain	BRN.DL.PRFRNTL.CRTX	Brain_Dorsolateral_Prefrontal_Cortex		11_TxEnh3	H3K4me1_Enh		H3K27ac_Enh	H3K9ac_Pro
E074	Brain	BRN.SUB.NIG	Brain Substantia Nigra		11_TxEnh3	H3K4me1_Enh
E075	Digestive	GI.CLN.MUC	Colonic Mucosa
E076	Sm. Muscle	GI.CLN.SM.MUS	Colon Smooth Muscle
E077	Digestive	GI.DUO.MUC	Duodenum Mucosa
E078	Sm. Muscle	GI.DUO.SM.MUS	Duodenum Smooth Muscle		11_TxEnh3
E079	Digestive	GI.ESO	Esophagus
E080	Other	ADRL.GLND.FET	Fetal Adrenal Gland	6_EnhG		H3K4me1_Enh
E081	Brain	BRN.FET.M	Fetal Brain Male							DNase
E082	Brain	BRN.FET.F	Fetal Brain Female			H3K4me1_Enh
E083	Heart	HRT.FET	Fetal Heart
E084	Digestive	GI.L.INT.FET	Fetal Intestine Large
E085	Digestive	GI.S.INT.FET	Fetal Intestine Small
E086	Other	KID.FET	Fetal Kidney
E087	Other	PANC.ISLT	Pancreatic Islets
E088	Other	LNG.FET	Fetal Lung			H3K4me1_Enh			H3K9ac_Pro
E089	Muscle	MUS.TRNK.FET	Fetal Muscle Trunk
E090	Muscle	MUS.LEG.FET	Fetal Muscle Leg
E091	Other	PLCNT.FET	Placenta
E092	Digestive	GI.STMC.FET	Fetal Stomach
E093	Thymus	THYM.FET	Fetal Thymus
E094	Digestive	GI.STMC.GAST	Gastric			H3K4me1_Enh
E095	Heart	HRT.VENT.L	Left Ventricle			H3K4me1_Enh		H3K27ac_Enh
E096	Other	LNG	Lung			H3K4me1_Enh
E097	Other	OVRY	Ovary			H3K4me1_Enh		H3K27ac_Enh
E098	Other	PANC	Pancreas
E099	Other	PLCNT.AMN	Placenta Amnion
E100	Muscle	MUS.PSOAS	Psoas Muscle
E101	Digestive	GI.RECT.MUC.29	Rectal Mucosa Donor 29
E102	Digestive	GI.RECT.MUC.31	Rectal Mucosa Donor 31			H3K4me1_Enh
E103	Sm. Muscle	GI.RECT.SM.MUS	Rectal Smooth Muscle
E104	Heart	HRT.ATR.R	Right Atrium	7_Enh
E105	Heart	HRT.VNT.R	Right Ventricle			H3K4me1_Enh
E106	Digestive	GI.CLN.SIG	Sigmoid Colon
E107	Muscle	MUS.SKLT.M	Skeletal Muscle Male		11_TxEnh3
E108	Muscle	MUS.SKLT.F	Skeletal Muscle Female		11_TxEnh3	H3K4me1_Enh
E109	Digestive	GI.S.INT	Small Intestine
E110	Digestive	GI.STMC.MUC	Stomach Mucosa
E111	Sm. Muscle	GI.STMC.MUS	Stomach Smooth Muscle		11_TxEnh3
E112	Thymus	THYM	Thymus
E113	Other	SPLN	Spleen			H3K4me1_Enh
E114	ENCODE2012	LNG.A549.ETOH002.CNCR	A549 EtOH 0.02pct Lung Carcinoma Cell Line
E115	ENCODE2012	BLD.DND41.CNCR	Dnd41 TCell Leukemia Cell Line
E116	ENCODE2012	BLD.GM12878	GM12878 Lymphoblastoid Cells
E117	ENCODE2012	CRVX.HELAS3.CNCR	HeLa-S3 Cervical Carcinoma Cell Line
E118	ENCODE2012	LIV.HEPG2.CNCR	HepG2 Hepatocellular Carcinoma Cell Line
E119	ENCODE2012	BRST.HMEC	HMEC Mammary Epithelial Primary Cells
E120	ENCODE2012	MUS.HSMM	HSMM Skeletal Muscle Myoblasts Cells
E121	ENCODE2012	MUS.HSMMT	HSMM cell derived Skeletal Muscle Myotubes Cells
E122	ENCODE2012	VAS.HUVEC	HUVEC Umbilical Vein Endothelial Primary Cells	6_EnhG		H3K4me1_Enh
E123	ENCODE2012	BLD.K562.CNCR	K562 Leukemia Cells
E124	ENCODE2012	BLD.CD14.MONO	Monocytes-CD14+ RO01746 Primary Cells					H3K27ac_Enh	H3K9ac_Pro
E125	ENCODE2012	BRN.NHA	NH-A Astrocytes Primary Cells
E126	ENCODE2012	SKIN.NHDFAD	NHDF-Ad Adult Dermal Fibroblast Primary Cells
E127	ENCODE2012	SKIN.NHEK	NHEK-Epidermal Keratinocyte Primary Cells
E128	ENCODE2012	LNG.NHLF	NHLF Lung Fibroblast Primary Cells
E129	ENCODE2012	BONE.OSTEO	Osteoblast Primary Cells		11_TxEnh3			H3K27ac_Enh

Proteins bound in ChIP-Seq experiments (ENCODE Project Consortium, 2011)

Cell ID Protein
H1-hESC POL2
H1-hESC POL2

Hits from selected eQTL studies

Study ID Paper Title PMID Tissue Correlated gene p-value
GTEx2015_v6 The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans 25954001 Testis LACTBL1 4.42659297243083e-11

Regulatory motifs altered

Position Weight Matrix ID
(Library from Kheradpour and Kellis, 2013) Strand Ref Alt Match on:
Ref: GTTCTGGAAGCTTAAAGTCTAAAATGGGTACACAGGGCTGCATTCATTACAGAGGCTCT
Alt: GTTCTGGAAGCTTAAAGTCTAAAATGGGTCCACAGGGCTGCATTCATTACAGAGGCTCT
AIRE_1 + 10.9 8.9
WHWDDWHHWGGWWNDWWHGGWBDHWW
HNF4_disc5 - -34.1 -22.2
GYCCWKTGT
Rad21_disc8 - 0.4 11.6
SNSSNSNKSSCDSS

Closest annotated gene
Source	Distance	Direction	ID/Link	Common name	Description
GENCODE	NA	Within gene	ENSG00000240553.1	RP1-184J9.2
RefSeq	NA	Within gene	NM_001142546	LUZP1	leucine zipper protein 1 [Source:HGNC Symbol;Acc:14985]

Study ID	Paper Title	PMID	Tissue	Correlated gene	p-value
GTEx2015_v6	The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans	25954001	Testis	LACTBL1	4.42659297243083e-11

Position Weight Matrix ID (Library from Kheradpour and Kellis, 2013)	Strand	Ref	Alt	Match on: Ref: GTTCTGGAAGCTTAAAGTCTAAAATGGGTACACAGGGCTGCATTCATTACAGAGGCTCT Alt: GTTCTGGAAGCTTAAAGTCTAAAATGGGTCCACAGGGCTGCATTCATTACAGAGGCTCT
AIRE_1	+	10.9	8.9	WHWDDWHHWGGWWNDWWHGGWBDHWW
HNF4_disc5	-	-34.1	-22.2	GYCCWKTGT
Rad21_disc8	-	0.4	11.6	SNSSNSNKSSCDSS