Detail view for rs200399390

Link to dbSNP entry

Link to Ensembl Variation entry
Sequence facts
chr pos (hg19) chr pos (hg38) Reference Alternate 1000 Genomes Phase 1 Frequencies Sequence constraint dbSNP functional annotation
AFR AMR ASN EUR by GERP by SiPhy
chr1 31441015 chr1 30968168 G A 0 0 0 0 Yes Yes intronic
Closest annotated gene
Source Distance Direction ID/Link Common name Description
GENCODE NA Within gene ENSG00000200181.1 SNORD85 small nucleolar RNA, C/D box 85 [Source:HGNC Symbol;Acc:32744]
RefSeq NA Within gene NR_003066 SNORD85 small nucleolar RNA, C/D box 85 [Source:HGNC Symbol;Acc:32744]
Regulatory chromatin states from DNAse and histone ChIP-Seq (Roadmap Epigenomics Consortium, 2015)

(Black = missing data)

Epigenome ID (EID)	Group	Mnemonic	Description	Chromatin states (Core 15-state model)	Chromatin states (25-state model using 12 imputed marks)	H3K4me1	H3K4me3	H3K27ac	H3K9ac	DNase
E001	ESC	ESC.I3	ES-I3 Cells	6_EnhG		H3K4me1_Enh
E002	ESC	ESC.WA7	ES-WA7 Cells			H3K4me1_Enh	H3K4me3_Pro
E003	ESC	ESC.H1	H1 Cells
E004	ES-deriv	ESDR.H1.BMP4.MESO	H1 BMP4 Derived Mesendoderm Cultured Cells
E005	ES-deriv	ESDR.H1.BMP4.TROP	H1 BMP4 Derived Trophoblast Cultured Cells
E006	ES-deriv	ESDR.H1.MSC	H1 Derived Mesenchymal Stem Cells	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E007	ES-deriv	ESDR.H1.NEUR.PROG	H1 Derived Neuronal Progenitor Cultured Cells
E008	ESC	ESC.H9	H9 Cells
E009	ES-deriv	ESDR.H9.NEUR.PROG	H9 Derived Neuronal Progenitor Cultured Cells
E010	ES-deriv	ESDR.H9.NEUR	H9 Derived Neuron Cultured Cells
E011	ES-deriv	ESDR.CD184.ENDO	hESC Derived CD184+ Endoderm Cultured Cells			H3K4me1_Enh		H3K27ac_Enh
E012	ES-deriv	ESDR.CD56.ECTO	hESC Derived CD56+ Ectoderm Cultured Cells
E013	ES-deriv	ESDR.CD56.MESO	hESC Derived CD56+ Mesoderm Cultured Cells			H3K4me1_Enh		H3K27ac_Enh
E014	ESC	ESC.HUES48	HUES48 Cells					H3K27ac_Enh
E015	ESC	ESC.HUES6	HUES6 Cells
E016	ESC	ESC.HUES64	HUES64 Cells					H3K27ac_Enh
E017	IMR90	LNG.IMR90	IMR90 fetal lung fibroblasts Cell Line	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E018	iPSC	IPSC.15b	iPS-15b Cells
E019	iPSC	IPSC.18	iPS-18 Cells
E020	iPSC	IPSC.20B	iPS-20b Cells			H3K4me1_Enh
E021	iPSC	IPSC.DF.6.9	iPS DF 6.9 Cells	6_EnhG
E022	iPSC	IPSC.DF.19.11	iPS DF 19.11 Cells					H3K27ac_Enh
E023	Mesench	FAT.MSC.DR.ADIP	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells			H3K4me1_Enh
E024	ESC	ESC.4STAR	ES-UCSF4 Cells
E025	Mesench	FAT.ADIP.DR.MSC	Adipose Derived Mesenchymal Stem Cell Cultured Cells			H3K4me1_Enh
E026	Mesench	STRM.MRW.MSC	Bone Marrow Derived Cultured Mesenchymal Stem Cells
E027	Epithelial	BRST.MYO	Breast Myoepithelial Primary Cells	6_EnhG		H3K4me1_Enh
E028	Epithelial	BRST.HMEC.35	Breast variant Human Mammary Epithelial Cells (vHMEC)			H3K4me1_Enh
E029	HSC & B-cell	BLD.CD14.PC	Primary monocytes from peripheral blood
E030	HSC & B-cell	BLD.CD15.PC	Primary neutrophils from peripheral blood
E031	HSC & B-cell	BLD.CD19.CPC	Primary B cells from cord blood
E032	HSC & B-cell	BLD.CD19.PPC	Primary B cells from peripheral blood
E033	Blood & T-cell	BLD.CD3.CPC	Primary T cells from cord blood
E034	Blood & T-cell	BLD.CD3.PPC	Primary T cells from peripheral blood
E035	HSC & B-cell	BLD.CD34.PC	Primary hematopoietic stem cells
E036	HSC & B-cell	BLD.CD34.CC	Primary hematopoietic stem cells short term culture
E037	Blood & T-cell	BLD.CD4.MPC	Primary T helper memory cells from peripheral blood 2			H3K4me1_Enh		H3K27ac_Enh
E038	Blood & T-cell	BLD.CD4.NPC	Primary T helper naive cells from peripheral blood
E039	Blood & T-cell	BLD.CD4.CD25M.CD45RA.NPC	Primary T helper naive cells from peripheral blood					H3K27ac_Enh
E040	Blood & T-cell	BLD.CD4.CD25M.CD45RO.MPC	Primary T helper memory cells from peripheral blood 1			H3K4me1_Enh		H3K27ac_Enh
E041	Blood & T-cell	BLD.CD4.CD25M.IL17M.PL.TPC	Primary T helper cells PMA-I stimulated
E042	Blood & T-cell	BLD.CD4.CD25M.IL17P.PL.TPC	Primary T helper 17 cells PMA-I stimulated
E043	Blood & T-cell	BLD.CD4.CD25M.TPC	Primary T helper cells from peripheral blood
E044	Blood & T-cell	BLD.CD4.CD25.CD127M.TREGPC	Primary T regulatory cells from peripheral blood					H3K27ac_Enh
E045	Blood & T-cell	BLD.CD4.CD25I.CD127.TMEMPC	Primary T cells effector/memory enriched from peripheral blood
E046	HSC & B-cell	BLD.CD56.PC	Primary Natural Killer cells from peripheral blood
E047	Blood & T-cell	BLD.CD8.NPC	Primary T CD8+ naive cells from peripheral blood
E048	Blood & T-cell	BLD.CD8.MPC	Primary T CD8+ memory cells from peripheral blood
E049	Mesench	STRM.CHON.MRW.DR.MSC	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells			H3K4me1_Enh		H3K27ac_Enh	H3K9ac_Pro
E050	HSC & B-cell	BLD.MOB.CD34.PC.F	Primary hematopoietic stem cells G-CSF-mobilized Female					H3K27ac_Enh
E051	HSC & B-cell	BLD.MOB.CD34.PC.M	Primary hematopoietic stem cells G-CSF-mobilized Male
E052	Myosat	MUS.SAT	Muscle Satellite Cultured Cells	6_EnhG	10_TxEnh5	H3K4me1_Enh
E053	Neurosph	BRN.CRTX.DR.NRSPHR	Cortex derived primary cultured neurospheres
E054	Neurosph	BRN.GANGEM.DR.NRSPHR	Ganglion Eminence derived primary cultured neurospheres
E055	Epithelial	SKIN.PEN.FRSK.FIB.01	Foreskin Fibroblast Primary Cells skin01	6_EnhG	12_TxEnhW	H3K4me1_Enh	H3K4me3_Pro	H3K27ac_Enh
E056	Epithelial	SKIN.PEN.FRSK.FIB.02	Foreskin Fibroblast Primary Cells skin02		12_TxEnhW	H3K4me1_Enh	H3K4me3_Pro	H3K27ac_Enh
E057	Epithelial	SKIN.PEN.FRSK.KER.02	Foreskin Keratinocyte Primary Cells skin02	6_EnhG		H3K4me1_Enh
E058	Epithelial	SKIN.PEN.FRSK.KER.03	Foreskin Keratinocyte Primary Cells skin03	6_EnhG	10_TxEnh5	H3K4me1_Enh		H3K27ac_Enh
E059	Epithelial	SKIN.PEN.FRSK.MEL.01	Foreskin Melanocyte Primary Cells skin01				H3K4me3_Pro
E061	Epithelial	SKIN.PEN.FRSK.MEL.03	Foreskin Melanocyte Primary Cells skin03	6_EnhG		H3K4me1_Enh
E062	Blood & T-cell	BLD.PER.MONUC.PC	Primary mononuclear cells from peripheral blood
E063	Adipose	FAT.ADIP.NUC	Adipose Nuclei			H3K4me1_Enh		H3K27ac_Enh
E065	Heart	VAS.AOR	Aorta	6_EnhG
E066	Other	LIV.ADLT	Liver	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E067	Brain	BRN.ANG.GYR	Brain Angular Gyrus			H3K4me1_Enh		H3K27ac_Enh
E068	Brain	BRN.ANT.CAUD	Brain Anterior Caudate
E069	Brain	BRN.CING.GYR	Brain Cingulate Gyrus			H3K4me1_Enh		H3K27ac_Enh
E070	Brain	BRN.GRM.MTRX	Brain Germinal Matrix			H3K4me1_Enh
E071	Brain	BRN.HIPP.MID	Brain Hippocampus Middle			H3K4me1_Enh		H3K27ac_Enh
E072	Brain	BRN.INF.TMP	Brain Inferior Temporal Lobe			H3K4me1_Enh	H3K4me3_Pro	H3K27ac_Enh
E073	Brain	BRN.DL.PRFRNTL.CRTX	Brain_Dorsolateral_Prefrontal_Cortex			H3K4me1_Enh	H3K4me3_Pro	H3K27ac_Enh
E074	Brain	BRN.SUB.NIG	Brain Substantia Nigra			H3K4me1_Enh	H3K4me3_Pro	H3K27ac_Enh
E075	Digestive	GI.CLN.MUC	Colonic Mucosa
E076	Sm. Muscle	GI.CLN.SM.MUS	Colon Smooth Muscle				H3K4me3_Pro	H3K27ac_Enh	H3K9ac_Pro
E077	Digestive	GI.DUO.MUC	Duodenum Mucosa	6_EnhG		H3K4me1_Enh
E078	Sm. Muscle	GI.DUO.SM.MUS	Duodenum Smooth Muscle			H3K4me1_Enh		H3K27ac_Enh
E079	Digestive	GI.ESO	Esophagus	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E080	Other	ADRL.GLND.FET	Fetal Adrenal Gland	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E081	Brain	BRN.FET.M	Fetal Brain Male			H3K4me1_Enh
E082	Brain	BRN.FET.F	Fetal Brain Female			H3K4me1_Enh
E083	Heart	HRT.FET	Fetal Heart	7_Enh	10_TxEnh5	H3K4me1_Enh	H3K4me3_Pro		H3K9ac_Pro
E084	Digestive	GI.L.INT.FET	Fetal Intestine Large	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E085	Digestive	GI.S.INT.FET	Fetal Intestine Small	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E086	Other	KID.FET	Fetal Kidney	6_EnhG		H3K4me1_Enh
E087	Other	PANC.ISLT	Pancreatic Islets			H3K4me1_Enh		H3K27ac_Enh
E088	Other	LNG.FET	Fetal Lung
E089	Muscle	MUS.TRNK.FET	Fetal Muscle Trunk	6_EnhG				H3K27ac_Enh
E090	Muscle	MUS.LEG.FET	Fetal Muscle Leg	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E091	Other	PLCNT.FET	Placenta
E092	Digestive	GI.STMC.FET	Fetal Stomach	6_EnhG		H3K4me1_Enh
E093	Thymus	THYM.FET	Fetal Thymus
E094	Digestive	GI.STMC.GAST	Gastric			H3K4me1_Enh		H3K27ac_Enh
E095	Heart	HRT.VENT.L	Left Ventricle	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E096	Other	LNG	Lung
E097	Other	OVRY	Ovary	6_EnhG		H3K4me1_Enh
E098	Other	PANC	Pancreas	6_EnhG		H3K4me1_Enh
E099	Other	PLCNT.AMN	Placenta Amnion			H3K4me1_Enh
E100	Muscle	MUS.PSOAS	Psoas Muscle			H3K4me1_Enh
E101	Digestive	GI.RECT.MUC.29	Rectal Mucosa Donor 29
E102	Digestive	GI.RECT.MUC.31	Rectal Mucosa Donor 31
E103	Sm. Muscle	GI.RECT.SM.MUS	Rectal Smooth Muscle
E104	Heart	HRT.ATR.R	Right Atrium
E105	Heart	HRT.VNT.R	Right Ventricle			H3K4me1_Enh
E106	Digestive	GI.CLN.SIG	Sigmoid Colon
E107	Muscle	MUS.SKLT.M	Skeletal Muscle Male	6_EnhG		H3K4me1_Enh
E108	Muscle	MUS.SKLT.F	Skeletal Muscle Female	6_EnhG	10_TxEnh5	H3K4me1_Enh		H3K27ac_Enh
E109	Digestive	GI.S.INT	Small Intestine			H3K4me1_Enh		H3K27ac_Enh
E110	Digestive	GI.STMC.MUC	Stomach Mucosa			H3K4me1_Enh
E111	Sm. Muscle	GI.STMC.MUS	Stomach Smooth Muscle			H3K4me1_Enh
E112	Thymus	THYM	Thymus
E113	Other	SPLN	Spleen	6_EnhG			H3K4me3_Pro	H3K27ac_Enh
E114	ENCODE2012	LNG.A549.ETOH002.CNCR	A549 EtOH 0.02pct Lung Carcinoma Cell Line	6_EnhG	10_TxEnh5	H3K4me1_Enh
E115	ENCODE2012	BLD.DND41.CNCR	Dnd41 TCell Leukemia Cell Line
E116	ENCODE2012	BLD.GM12878	GM12878 Lymphoblastoid Cells
E117	ENCODE2012	CRVX.HELAS3.CNCR	HeLa-S3 Cervical Carcinoma Cell Line	6_EnhG	10_TxEnh5	H3K4me1_Enh
E118	ENCODE2012	LIV.HEPG2.CNCR	HepG2 Hepatocellular Carcinoma Cell Line
E119	ENCODE2012	BRST.HMEC	HMEC Mammary Epithelial Primary Cells	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E120	ENCODE2012	MUS.HSMM	HSMM Skeletal Muscle Myoblasts Cells	6_EnhG		H3K4me1_Enh
E121	ENCODE2012	MUS.HSMMT	HSMM cell derived Skeletal Muscle Myotubes Cells	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E122	ENCODE2012	VAS.HUVEC	HUVEC Umbilical Vein Endothelial Primary Cells	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E123	ENCODE2012	BLD.K562.CNCR	K562 Leukemia Cells	6_EnhG		H3K4me1_Enh
E124	ENCODE2012	BLD.CD14.MONO	Monocytes-CD14+ RO01746 Primary Cells					H3K27ac_Enh
E125	ENCODE2012	BRN.NHA	NH-A Astrocytes Primary Cells	6_EnhG		H3K4me1_Enh		H3K27ac_Enh
E126	ENCODE2012	SKIN.NHDFAD	NHDF-Ad Adult Dermal Fibroblast Primary Cells			H3K4me1_Enh
E127	ENCODE2012	SKIN.NHEK	NHEK-Epidermal Keratinocyte Primary Cells	6_EnhG	10_TxEnh5	H3K4me1_Enh		H3K27ac_Enh	H3K9ac_Pro
E128	ENCODE2012	LNG.NHLF	NHLF Lung Fibroblast Primary Cells	6_EnhG		H3K4me1_Enh
E129	ENCODE2012	BONE.OSTEO	Osteoblast Primary Cells	6_EnhG		H3K4me1_Enh		H3K27ac_Enh

Regulatory motifs altered

Position Weight Matrix ID
(Library from Kheradpour and Kellis, 2013) Strand Ref Alt Match on:
Ref: TTAGATACCTCCAATATGACTTAAGACTGGCTCAGAACAATGCTCTCATCAGTGAACTA
Alt: TTAGATACCTCCAATATGACTTAAGACTGACTCAGAACAATGCTCTCATCAGTGAACTA
AP-1_known1 + 2.3 14.3
RVTGACTMMKW
AP-1_known2 + 0.3 12.1
TGAMTCA
AP-1_known3 + 6.5 11.4
VTGACTHA
AP-1_known4 + 1.3 13.3
MTGASTMAB
AP-2_disc1 + 0.8 12.8
VVTGASTCAB
BATF_disc1 - 2.8 14.7
TGASTCABHNM
BCL_disc2 - 0.7 12.7
RMTGASTCAK
Bach1 + -4.5 7.5
RBSATGACTCAYSNB
GATA_disc2 - 1.5 13.5
SHVTGAVTCA
GR_disc2 - 2.1 14.1
VTGASTCABN
HMGN3_disc1 - 0.7 12.7
SSVTGASTCA
Irf_disc2 + 1 13
HTGASTCADH
KAP1_disc1 - 1.3 13.2
NDVTGASTCA
Maf_disc1 - -5.4 6.6
TGASTCAKCA
Maf_known1 + 8.2 12.4
HTGMCTCMRSM
Myc_disc3 - 1.3 13.2
VVTGASTCAB
Sox_15 + 11.9 11.7
NWWNANAACAATDR
TCF4_disc1 - 1.4 13.3
NVTGASTCAB
p300_disc1 + 0.9 12.8
VTGASTCABN

Closest annotated gene
Source	Distance	Direction	ID/Link	Common name	Description
GENCODE	NA	Within gene	ENSG00000200181.1	SNORD85	small nucleolar RNA, C/D box 85 [Source:HGNC Symbol;Acc:32744]
RefSeq	NA	Within gene	NR_003066	SNORD85	small nucleolar RNA, C/D box 85 [Source:HGNC Symbol;Acc:32744]

Position Weight Matrix ID (Library from Kheradpour and Kellis, 2013)	Strand	Ref	Alt	Match on: Ref: TTAGATACCTCCAATATGACTTAAGACTGGCTCAGAACAATGCTCTCATCAGTGAACTA Alt: TTAGATACCTCCAATATGACTTAAGACTGACTCAGAACAATGCTCTCATCAGTGAACTA
AP-1_known1	+	2.3	14.3	RVTGACTMMKW
AP-1_known2	+	0.3	12.1	TGAMTCA
AP-1_known3	+	6.5	11.4	VTGACTHA
AP-1_known4	+	1.3	13.3	MTGASTMAB
AP-2_disc1	+	0.8	12.8	VVTGASTCAB
BATF_disc1	-	2.8	14.7	TGASTCABHNM
BCL_disc2	-	0.7	12.7	RMTGASTCAK
Bach1	+	-4.5	7.5	RBSATGACTCAYSNB
GATA_disc2	-	1.5	13.5	SHVTGAVTCA
GR_disc2	-	2.1	14.1	VTGASTCABN
HMGN3_disc1	-	0.7	12.7	SSVTGASTCA
Irf_disc2	+	1	13	HTGASTCADH
KAP1_disc1	-	1.3	13.2	NDVTGASTCA
Maf_disc1	-	-5.4	6.6	TGASTCAKCA
Maf_known1	+	8.2	12.4	HTGMCTCMRSM
Myc_disc3	-	1.3	13.2	VVTGASTCAB
Sox_15	+	11.9	11.7	NWWNANAACAATDR
TCF4_disc1	-	1.4	13.3	NVTGASTCAB
p300_disc1	+	0.9	12.8	VTGASTCABN