Link to Ensembl Variation entry
Sequence facts
| chr | pos (hg19) | chr | pos (hg38) | Reference | Alternate | 1000 Genomes Phase 1 Frequencies | Sequence constraint | dbSNP functional annotation | ||||
| AFR | AMR | ASN | EUR | by GERP | by SiPhy | |||||||
| chr1 | 11967905 | chr1 | 11907848 | G | C | 0.6 | 0.48 | 0.6 | 0.54 | Yes | Yes | none |
| Closest annotated gene | |||||
| Source | Distance | Direction | ID/Link | Common name | Description |
| GENCODE | 5' | 303 | ENSG00000199347.1 | RNU5E-1 | RNA, U5E small nuclear 1 [Source:HGNC Symbol;Acc:10215] |
| RefSeq | 3' | 11738 | NM_138346 | KIAA2013 | KIAA2013 [Source:HGNC Symbol;Acc:28513] |
Regulatory chromatin states from DNAse and histone ChIP-Seq (Roadmap Epigenomics Consortium, 2015)
| Epigenome ID (EID) | Group | Mnemonic | Description | Chromatin states (Core 15-state model) | Chromatin states (25-state model using 12 imputed marks) | H3K4me1 | H3K4me3 | H3K27ac | H3K9ac | DNase |
| E001 | ESC | ESC.I3 | ES-I3 Cells | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | H3K9ac_Pro | |||
| E002 | ESC | ESC.WA7 | ES-WA7 Cells | 22_PromP | ||||||
| E003 | ESC | ESC.H1 | H1 Cells | 22_PromP | H3K4me1_Enh | H3K27ac_Enh | H3K9ac_Pro | DNase | ||
| E004 | ES-deriv | ESDR.H1.BMP4.MESO | H1 BMP4 Derived Mesendoderm Cultured Cells | 22_PromP | H3K27ac_Enh | H3K9ac_Pro | DNase | |||
| E005 | ES-deriv | ESDR.H1.BMP4.TROP | H1 BMP4 Derived Trophoblast Cultured Cells | 22_PromP | H3K27ac_Enh | H3K9ac_Pro | DNase | |||
| E006 | ES-deriv | ESDR.H1.MSC | H1 Derived Mesenchymal Stem Cells | 22_PromP | H3K9ac_Pro | DNase | ||||
| E007 | ES-deriv | ESDR.H1.NEUR.PROG | H1 Derived Neuronal Progenitor Cultured Cells | 22_PromP | H3K27ac_Enh | DNase | ||||
| E008 | ESC | ESC.H9 | H9 Cells | 18_EnhAc | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | DNase | ||
| E009 | ES-deriv | ESDR.H9.NEUR.PROG | H9 Derived Neuronal Progenitor Cultured Cells | 7_Enh | 22_PromP | H3K4me1_Enh | ||||
| E010 | ES-deriv | ESDR.H9.NEUR | H9 Derived Neuron Cultured Cells | 7_Enh | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | |||
| E011 | ES-deriv | ESDR.CD184.ENDO | hESC Derived CD184+ Endoderm Cultured Cells | 14_EnhA2 | H3K27ac_Enh | H3K9ac_Pro | ||||
| E012 | ES-deriv | ESDR.CD56.ECTO | hESC Derived CD56+ Ectoderm Cultured Cells | 16_EnhW1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | |||
| E013 | ES-deriv | ESDR.CD56.MESO | hESC Derived CD56+ Mesoderm Cultured Cells | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | |||
| E014 | ESC | ESC.HUES48 | HUES48 Cells | 16_EnhW1 | H3K4me1_Enh | H3K27ac_Enh | H3K9ac_Pro | |||
| E015 | ESC | ESC.HUES6 | HUES6 Cells | 7_Enh | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |
| E016 | ESC | ESC.HUES64 | HUES64 Cells | 14_EnhA2 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E017 | IMR90 | LNG.IMR90 | IMR90 fetal lung fibroblasts Cell Line | 22_PromP | H3K27ac_Enh | H3K9ac_Pro | DNase | |||
| E018 | iPSC | IPSC.15b | iPS-15b Cells | 22_PromP | H3K4me1_Enh | H3K9ac_Pro | ||||
| E019 | iPSC | IPSC.18 | iPS-18 Cells | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E020 | iPSC | IPSC.20B | iPS-20b Cells | 13_EnhA1 | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |||
| E021 | iPSC | IPSC.DF.6.9 | iPS DF 6.9 Cells | 22_PromP | H3K27ac_Enh | DNase | ||||
| E022 | iPSC | IPSC.DF.19.11 | iPS DF 19.11 Cells | 18_EnhAc | H3K27ac_Enh | DNase | ||||
| E023 | Mesench | FAT.MSC.DR.ADIP | Mesenchymal Stem Cell Derived Adipocyte Cultured Cells | 7_Enh | 22_PromP | H3K4me1_Enh | H3K9ac_Pro | |||
| E024 | ESC | ESC.4STAR | ES-UCSF4 Cells | 22_PromP | ||||||
| E025 | Mesench | FAT.ADIP.DR.MSC | Adipose Derived Mesenchymal Stem Cell Cultured Cells | 22_PromP | H3K9ac_Pro | |||||
| E026 | Mesench | STRM.MRW.MSC | Bone Marrow Derived Cultured Mesenchymal Stem Cells | 13_EnhA1 | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |||
| E027 | Epithelial | BRST.MYO | Breast Myoepithelial Primary Cells | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | H3K9ac_Pro | |||
| E028 | Epithelial | BRST.HMEC.35 | Breast variant Human Mammary Epithelial Cells (vHMEC) | 22_PromP | H3K4me1_Enh | DNase | ||||
| E029 | HSC & B-cell | BLD.CD14.PC | Primary monocytes from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K27ac_Enh | DNase | ||
| E030 | HSC & B-cell | BLD.CD15.PC | Primary neutrophils from peripheral blood | 1_TssA | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | |||
| E031 | HSC & B-cell | BLD.CD19.CPC | Primary B cells from cord blood | 2_TssAFlnk | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | |||
| E032 | HSC & B-cell | BLD.CD19.PPC | Primary B cells from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | DNase | |
| E033 | Blood & T-cell | BLD.CD3.CPC | Primary T cells from cord blood | 7_Enh | 13_EnhA1 | H3K4me3_Pro | DNase | |||
| E034 | Blood & T-cell | BLD.CD3.PPC | Primary T cells from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K27ac_Enh | DNase | ||
| E035 | HSC & B-cell | BLD.CD34.PC | Primary hematopoietic stem cells | 13_EnhA1 | H3K4me1_Enh | |||||
| E036 | HSC & B-cell | BLD.CD34.CC | Primary hematopoietic stem cells short term culture | 16_EnhW1 | H3K4me1_Enh | |||||
| E037 | Blood & T-cell | BLD.CD4.MPC | Primary T helper memory cells from peripheral blood 2 | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | ||
| E038 | Blood & T-cell | BLD.CD4.NPC | Primary T helper naive cells from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |
| E039 | Blood & T-cell | BLD.CD4.CD25M.CD45RA.NPC | Primary T helper naive cells from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | ||
| E040 | Blood & T-cell | BLD.CD4.CD25M.CD45RO.MPC | Primary T helper memory cells from peripheral blood 1 | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | ||
| E041 | Blood & T-cell | BLD.CD4.CD25M.IL17M.PL.TPC | Primary T helper cells PMA-I stimulated | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | ||
| E042 | Blood & T-cell | BLD.CD4.CD25M.IL17P.PL.TPC | Primary T helper 17 cells PMA-I stimulated | 13_EnhA1 | H3K4me1_Enh | H3K27ac_Enh | ||||
| E043 | Blood & T-cell | BLD.CD4.CD25M.TPC | Primary T helper cells from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | ||
| E044 | Blood & T-cell | BLD.CD4.CD25.CD127M.TREGPC | Primary T regulatory cells from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | ||
| E045 | Blood & T-cell | BLD.CD4.CD25I.CD127.TMEMPC | Primary T cells effector/memory enriched from peripheral blood | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | |||
| E046 | HSC & B-cell | BLD.CD56.PC | Primary Natural Killer cells from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | DNase | |
| E047 | Blood & T-cell | BLD.CD8.NPC | Primary T CD8+ naive cells from peripheral blood | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |
| E048 | Blood & T-cell | BLD.CD8.MPC | Primary T CD8+ memory cells from peripheral blood | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | |||
| E049 | Mesench | STRM.CHON.MRW.DR.MSC | Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E050 | HSC & B-cell | BLD.MOB.CD34.PC.F | Primary hematopoietic stem cells G-CSF-mobilized Female | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | DNase | |
| E051 | HSC & B-cell | BLD.MOB.CD34.PC.M | Primary hematopoietic stem cells G-CSF-mobilized Male | 7_Enh | 16_EnhW1 | H3K4me1_Enh | DNase | |||
| E052 | Myosat | MUS.SAT | Muscle Satellite Cultured Cells | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | H3K9ac_Pro | |||
| E053 | Neurosph | BRN.CRTX.DR.NRSPHR | Cortex derived primary cultured neurospheres | 1_TssA | 22_PromP | H3K4me3_Pro | ||||
| E054 | Neurosph | BRN.GANGEM.DR.NRSPHR | Ganglion Eminence derived primary cultured neurospheres | 22_PromP | H3K4me3_Pro | |||||
| E055 | Epithelial | SKIN.PEN.FRSK.FIB.01 | Foreskin Fibroblast Primary Cells skin01 | 15_EnhAF | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | DNase | ||
| E056 | Epithelial | SKIN.PEN.FRSK.FIB.02 | Foreskin Fibroblast Primary Cells skin02 | 1_TssA | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | DNase | |
| E057 | Epithelial | SKIN.PEN.FRSK.KER.02 | Foreskin Keratinocyte Primary Cells skin02 | 22_PromP | DNase | |||||
| E058 | Epithelial | SKIN.PEN.FRSK.KER.03 | Foreskin Keratinocyte Primary Cells skin03 | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | |||
| E059 | Epithelial | SKIN.PEN.FRSK.MEL.01 | Foreskin Melanocyte Primary Cells skin01 | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | DNase | ||
| E061 | Epithelial | SKIN.PEN.FRSK.MEL.03 | Foreskin Melanocyte Primary Cells skin03 | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | ||
| E062 | Blood & T-cell | BLD.PER.MONUC.PC | Primary mononuclear cells from peripheral blood | 16_EnhW1 | H3K4me1_Enh | H3K9ac_Pro | ||||
| E063 | Adipose | FAT.ADIP.NUC | Adipose Nuclei | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E065 | Heart | VAS.AOR | Aorta | 22_PromP | ||||||
| E066 | Other | LIV.ADLT | Liver | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |
| E067 | Brain | BRN.ANG.GYR | Brain Angular Gyrus | 14_EnhA2 | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |||
| E068 | Brain | BRN.ANT.CAUD | Brain Anterior Caudate | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E069 | Brain | BRN.CING.GYR | Brain Cingulate Gyrus | 14_EnhA2 | H3K27ac_Enh | H3K9ac_Pro | ||||
| E070 | Brain | BRN.GRM.MTRX | Brain Germinal Matrix | 22_PromP | H3K4me3_Pro | |||||
| E071 | Brain | BRN.HIPP.MID | Brain Hippocampus Middle | 22_PromP | H3K27ac_Enh | |||||
| E072 | Brain | BRN.INF.TMP | Brain Inferior Temporal Lobe | 14_EnhA2 | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |||
| E073 | Brain | BRN.DL.PRFRNTL.CRTX | Brain_Dorsolateral_Prefrontal_Cortex | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E074 | Brain | BRN.SUB.NIG | Brain Substantia Nigra | 22_PromP | H3K27ac_Enh | H3K9ac_Pro | ||||
| E075 | Digestive | GI.CLN.MUC | Colonic Mucosa | 16_EnhW1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E076 | Sm. Muscle | GI.CLN.SM.MUS | Colon Smooth Muscle | 7_Enh | 16_EnhW1 | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E077 | Digestive | GI.DUO.MUC | Duodenum Mucosa | 16_EnhW1 | H3K4me1_Enh | H3K9ac_Pro | ||||
| E078 | Sm. Muscle | GI.DUO.SM.MUS | Duodenum Smooth Muscle | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | |||
| E079 | Digestive | GI.ESO | Esophagus | 15_EnhAF | H3K4me3_Pro | H3K27ac_Enh | ||||
| E080 | Other | ADRL.GLND.FET | Fetal Adrenal Gland | 16_EnhW1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | DNase | ||
| E081 | Brain | BRN.FET.M | Fetal Brain Male | 7_Enh | 22_PromP | H3K4me1_Enh | DNase | |||
| E082 | Brain | BRN.FET.F | Fetal Brain Female | 22_PromP | H3K4me3_Pro | DNase | ||||
| E083 | Heart | HRT.FET | Fetal Heart | 22_PromP | H3K9ac_Pro | DNase | ||||
| E084 | Digestive | GI.L.INT.FET | Fetal Intestine Large | 14_EnhA2 | H3K27ac_Enh | DNase | ||||
| E085 | Digestive | GI.S.INT.FET | Fetal Intestine Small | 16_EnhW1 | H3K4me1_Enh | H3K27ac_Enh | DNase | |||
| E086 | Other | KID.FET | Fetal Kidney | 1_TssA | 14_EnhA2 | H3K4me3_Pro | H3K9ac_Pro | DNase | ||
| E087 | Other | PANC.ISLT | Pancreatic Islets | 22_PromP | H3K9ac_Pro | |||||
| E088 | Other | LNG.FET | Fetal Lung | 14_EnhA2 | H3K4me3_Pro | H3K9ac_Pro | DNase | |||
| E089 | Muscle | MUS.TRNK.FET | Fetal Muscle Trunk | 7_Enh | 14_EnhA2 | H3K4me1_Enh | H3K27ac_Enh | DNase | ||
| E090 | Muscle | MUS.LEG.FET | Fetal Muscle Leg | 7_Enh | 16_EnhW1 | H3K4me3_Pro | H3K27ac_Enh | DNase | ||
| E091 | Other | PLCNT.FET | Placenta | 7_Enh | 16_EnhW1 | H3K4me3_Pro | H3K27ac_Enh | DNase | ||
| E092 | Digestive | GI.STMC.FET | Fetal Stomach | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K27ac_Enh | DNase | ||
| E093 | Thymus | THYM.FET | Fetal Thymus | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | DNase | |
| E094 | Digestive | GI.STMC.GAST | Gastric | 22_PromP | H3K27ac_Enh | DNase | ||||
| E095 | Heart | HRT.VENT.L | Left Ventricle | 22_PromP | H3K27ac_Enh | |||||
| E096 | Other | LNG | Lung | 16_EnhW1 | H3K4me3_Pro | H3K27ac_Enh | ||||
| E097 | Other | OVRY | Ovary | 22_PromP | DNase | |||||
| E098 | Other | PANC | Pancreas | 22_PromP | H3K4me3_Pro | H3K27ac_Enh | DNase | |||
| E099 | Other | PLCNT.AMN | Placenta Amnion | 15_EnhAF | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | |||
| E100 | Muscle | MUS.PSOAS | Psoas Muscle | 22_PromP | H3K27ac_Enh | DNase | ||||
| E101 | Digestive | GI.RECT.MUC.29 | Rectal Mucosa Donor 29 | 14_EnhA2 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E102 | Digestive | GI.RECT.MUC.31 | Rectal Mucosa Donor 31 | 22_PromP | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E103 | Sm. Muscle | GI.RECT.SM.MUS | Rectal Smooth Muscle | 16_EnhW1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | ||
| E104 | Heart | HRT.ATR.R | Right Atrium | 22_PromP | H3K27ac_Enh | |||||
| E105 | Heart | HRT.VNT.R | Right Ventricle | 22_PromP | H3K27ac_Enh | |||||
| E106 | Digestive | GI.CLN.SIG | Sigmoid Colon | 22_PromP | H3K27ac_Enh | |||||
| E107 | Muscle | MUS.SKLT.M | Skeletal Muscle Male | 22_PromP | H3K4me1_Enh | H3K9ac_Pro | ||||
| E108 | Muscle | MUS.SKLT.F | Skeletal Muscle Female | 13_EnhA1 | H3K4me1_Enh | H3K27ac_Enh | H3K9ac_Pro | |||
| E109 | Digestive | GI.S.INT | Small Intestine | 16_EnhW1 | H3K4me3_Pro | H3K27ac_Enh | DNase | |||
| E110 | Digestive | GI.STMC.MUC | Stomach Mucosa | 16_EnhW1 | H3K4me1_Enh | H3K4me3_Pro | H3K9ac_Pro | |||
| E111 | Sm. Muscle | GI.STMC.MUS | Stomach Smooth Muscle | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |
| E112 | Thymus | THYM | Thymus | 14_EnhA2 | H3K4me3_Pro | H3K27ac_Enh | ||||
| E113 | Other | SPLN | Spleen | 15_EnhAF | H3K4me3_Pro | H3K27ac_Enh | ||||
| E114 | ENCODE2012 | LNG.A549.ETOH002.CNCR | A549 EtOH 0.02pct Lung Carcinoma Cell Line | 1_TssA | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | DNase |
| E115 | ENCODE2012 | BLD.DND41.CNCR | Dnd41 TCell Leukemia Cell Line | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | |
| E116 | ENCODE2012 | BLD.GM12878 | GM12878 Lymphoblastoid Cells | 7_Enh | 13_EnhA1 | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | DNase | |
| E117 | ENCODE2012 | CRVX.HELAS3.CNCR | HeLa-S3 Cervical Carcinoma Cell Line | 2_TssAFlnk | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | DNase |
| E118 | ENCODE2012 | LIV.HEPG2.CNCR | HepG2 Hepatocellular Carcinoma Cell Line | 1_TssA | 13_EnhA1 | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | DNase | |
| E119 | ENCODE2012 | BRST.HMEC | HMEC Mammary Epithelial Primary Cells | 7_Enh | 13_EnhA1 | H3K27ac_Enh | H3K9ac_Pro | DNase | ||
| E120 | ENCODE2012 | MUS.HSMM | HSMM Skeletal Muscle Myoblasts Cells | 22_PromP | H3K27ac_Enh | H3K9ac_Pro | DNase | |||
| E121 | ENCODE2012 | MUS.HSMMT | HSMM cell derived Skeletal Muscle Myotubes Cells | 13_EnhA1 | H3K27ac_Enh | H3K9ac_Pro | DNase | |||
| E122 | ENCODE2012 | VAS.HUVEC | HUVEC Umbilical Vein Endothelial Primary Cells | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K27ac_Enh | H3K9ac_Pro | DNase | |
| E123 | ENCODE2012 | BLD.K562.CNCR | K562 Leukemia Cells | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | DNase |
| E124 | ENCODE2012 | BLD.CD14.MONO | Monocytes-CD14+ RO01746 Primary Cells | 2_PromU | H3K4me1_Enh | H3K27ac_Enh | H3K9ac_Pro | DNase | ||
| E125 | ENCODE2012 | BRN.NHA | NH-A Astrocytes Primary Cells | 7_Enh | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | DNase |
| E126 | ENCODE2012 | SKIN.NHDFAD | NHDF-Ad Adult Dermal Fibroblast Primary Cells | 7_Enh | 13_EnhA1 | H3K27ac_Enh | H3K9ac_Pro | DNase | ||
| E127 | ENCODE2012 | SKIN.NHEK | NHEK-Epidermal Keratinocyte Primary Cells | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh | H3K9ac_Pro | DNase | |
| E128 | ENCODE2012 | LNG.NHLF | NHLF Lung Fibroblast Primary Cells | 15_EnhAF | H3K27ac_Enh | H3K9ac_Pro | DNase | |||
| E129 | ENCODE2012 | BONE.OSTEO | Osteoblast Primary Cells | 13_EnhA1 | H3K4me1_Enh | H3K4me3_Pro | H3K27ac_Enh |
Proteins bound in ChIP-Seq experiments (ENCODE Project Consortium, 2011)
| Cell ID | Protein |
| A549 | CTCF |
| A549 | CTCF |
| AG04449 | CTCF |
| AG04450 | CTCF |
| AG09309 | CTCF |
| AG09319 | CTCF |
| AG10803 | CTCF |
| AoAF | CTCF |
| BJ | CTCF |
| Caco-2 | CTCF |
| Fibrobl | CTCF |
| GM06990 | CTCF |
| GM12864 | CTCF |
| GM12865 | CTCF |
| GM12872 | CTCF |
| GM12873 | CTCF |
| GM12874 | CTCF |
| GM12875 | CTCF |
| GM12878 | CTCF |
| GM12878 | CTCF |
| GM12878 | CTCF |
| GM12878 | CTCF |
| GM12878 | NRF1 |
| GM12878 | RAD21 |
| GM12878 | RAD21 |
| GM12878 | RXRA |
| GM12878 | SMC3 |
| GM12878 | SRF |
| GM12878 | ZNF143 |
| Gliobla | CTCF |
| H1-hESC | CTCF |
| H1-hESC | CTCF |
| H1-hESC | JUND |
| H1-hESC | RAD21 |
| H1-hESC | RAD21 |
| H1-hESC | SRF |
| HA-sp | CTCF |
| HBMEC | CTCF |
| HCFaa | CTCF |
| HCPEpiC | CTCF |
| HEEpiC | CTCF |
| HEK293(b) | ELK4 |
| HEK293 | CTCF |
| HL-60 | CTCF |
| HMEC | CTCF |
| HMEC | CTCF |
| HMF | CTCF |
| HPAF | CTCF |
| HPF | CTCF |
| HRE | CTCF |
| HRPEpiC | CTCF |
| HSMM | CTCF |
| HSMMtube | CTCF |
| HUVEC | CTCF |
| HUVEC | CTCF |
| HUVEC | CTCF |
| HeLa-S3 | AP2ALPHA |
| HeLa-S3 | AP2GAMMA |
| HeLa-S3 | CJUN |
| HeLa-S3 | CTCF |
| HeLa-S3 | CTCF |
| HeLa-S3 | CTCF |
| HeLa-S3 | RAD21 |
| HeLa-S3 | SMC3 |
| HepG2 | CTCF |
| HepG2 | CTCF |
| HepG2 | CTCF |
| HepG2 | CTCF |
| HepG2 | RAD21 |
| HepG2 | RAD21 |
| HepG2 | SRF |
| K562 | CCNT2 |
| K562 | CMYC |
| K562 | CMYC |
| K562 | CTCF |
| K562 | CTCF |
| K562 | CTCF |
| K562 | CTCFL |
| K562 | ELF1 |
| K562 | MAX |
| K562 | NFYA |
| K562 | NRF1 |
| K562 | RAD21 |
| K562 | RAD21 |
| K562 | SMC3 |
| K562 | SRF |
| MCF-7 | CTCF |
| MCF-7 | CTCF |
| MCF-7 | CTCF |
| NH-A | CTCF |
| NHDF-Ad | CTCF |
| NHEK | CTCF |
| NHEK | CTCF |
| NHLF | CTCF |
| Osteobl | CTCF |
| PBDE | POL2 |
| ProgFib | CTCF |
| SAEC | CTCF |
| SK-N-SH_RA | CTCF |
| SK-N-SH_RA | CTCF |
| SK-N-SH_RA | RAD21 |
| WERI-Rb-1 | CTCF |
Hits from selected eQTL studies
| Study ID | Paper Title | PMID | Tissue | Correlated gene | p-value |
| GTEx2015_v6 | The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans | 25954001 | Esophagus_Mucosa | MFN2 | 4.0270227185345e-06 |
| GTEx2015_v6 | The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans | 25954001 | Testis | MFN2 | 1.12273387041516e-06 |
| GTEx2015_v6 | The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans | 25954001 | Whole_Blood | KIAA2013 | 9.47440791454587e-07 |
| Westra2013 | Systematic identification of trans eQTLs as putative drivers of known disease associations | 24013639 | Whole_Blood | KIAA2013|NPPA | 2.6809141772571974E-7 |
| Westra2013 | Systematic identification of trans eQTLs as putative drivers of known disease associations | 24013639 | Whole_Blood | MFN2 | 2.221147398994037E-37 |
| Westra2013 | Systematic identification of trans eQTLs as putative drivers of known disease associations | 24013639 | Whole_Blood | PLOD1 | 1.0156510540529986E-60 |
Regulatory motifs altered
| Position Weight Matrix ID (Library from Kheradpour and Kellis, 2013) | Strand | Ref | Alt | Match on:Ref: TCTTCTGGGACCAGACTCTGCTCTGCCCCGCGGTGGTGGCCTCAGGCGCAGCGCTAAAA |
| CTCF_disc1 | + | -0.5 | 11.2 | DNHWMBRSYRCCMYCTASTGGH |
| CTCF_disc2 | - | -4.6 | 7.3 | YGCCMCCTGGT |
| CTCF_disc5 | - | 7.5 | 14.3 | SHGSSHBCHSSHSS |
| CTCF_disc7 | - | 8.3 | 12.2 | CCCCWGSYGG |
| CTCF_disc9 | - | 12.2 | 12.8 | SHKSSCHSYDSDSNNS |
| CTCF_known1 | - | 3.1 | 15.1 | BRSYGCCMYCTRSTGGYHR |
| ERalpha-a_disc4 | - | 10.4 | 9.9 | SHBSNSNSNSCHNS |
| Ets_disc9 | - | 9.6 | 11.3 | SNCBBSSBSSNS |
| Rad21_disc1 | - | 6 | 13.9 | WMBRSYGCCMYCTRSTGGYH |
| Rad21_disc5 | - | 10.7 | 11.4 | BNSHSCCMNSYNS |
| Rad21_disc6 | - | 10.1 | 12.2 | VSYDSSMNSNNSNDSNS |
| Rad21_disc7 | + | 10.7 | 12 | SBNSSHBSNNSWGSS |
| Rad21_disc8 | + | 10.8 | 11.7 | SSHGSSMNSNSSNS |
| SMC3_disc1 | - | 10.3 | 17.1 | SYGCCMYCTGSTGGY |
| SP1_disc3 | - | 5.3 | 10.9 | SYCCYKCCYYCHNVS |
| Zic_4 | + | 11.5 | 14.9 | BMCCCCCKGGGGKSB |
| p300_disc9 | - | 11 | 11.6 | SNSSNSNSNSNNSSNSS |