Link to Ensembl Variation entry
Sequence facts
| chr | pos (hg19) | chr | pos (hg38) | Reference | Alternate | 1000 Genomes Phase 1 Frequencies | Sequence constraint | dbSNP functional annotation | ||||
| AFR | AMR | ASN | EUR | by GERP | by SiPhy | |||||||
| chr1 | 23413027 | chr1 | 23086534 | T | C | 0.83 | 0.64 | 0.79 | 0.83 | No | No | 3'-UTR |
| Closest annotated gene | |||||
| Source | Distance | Direction | ID/Link | Common name | Description |
| GENCODE | NA | Within gene | ENSG00000240553.1 | RP1-184J9.2 | |
| RefSeq | NA | Within gene | NM_001142546 | LUZP1 | leucine zipper protein 1 [Source:HGNC Symbol;Acc:14985] |
Regulatory chromatin states from DNAse and histone ChIP-Seq (Roadmap Epigenomics Consortium, 2015)
| Epigenome ID (EID) | Group | Mnemonic | Description | Chromatin states (Core 15-state model) | Chromatin states (25-state model using 12 imputed marks) | H3K4me1 | H3K4me3 | H3K27ac | H3K9ac | DNase |
| E001 | ESC | ESC.I3 | ES-I3 Cells | |||||||
| E002 | ESC | ESC.WA7 | ES-WA7 Cells | |||||||
| E003 | ESC | ESC.H1 | H1 Cells | |||||||
| E004 | ES-deriv | ESDR.H1.BMP4.MESO | H1 BMP4 Derived Mesendoderm Cultured Cells | |||||||
| E005 | ES-deriv | ESDR.H1.BMP4.TROP | H1 BMP4 Derived Trophoblast Cultured Cells | |||||||
| E006 | ES-deriv | ESDR.H1.MSC | H1 Derived Mesenchymal Stem Cells | |||||||
| E007 | ES-deriv | ESDR.H1.NEUR.PROG | H1 Derived Neuronal Progenitor Cultured Cells | |||||||
| E008 | ESC | ESC.H9 | H9 Cells | |||||||
| E009 | ES-deriv | ESDR.H9.NEUR.PROG | H9 Derived Neuronal Progenitor Cultured Cells | |||||||
| E010 | ES-deriv | ESDR.H9.NEUR | H9 Derived Neuron Cultured Cells | |||||||
| E011 | ES-deriv | ESDR.CD184.ENDO | hESC Derived CD184+ Endoderm Cultured Cells | H3K27ac_Enh | ||||||
| E012 | ES-deriv | ESDR.CD56.ECTO | hESC Derived CD56+ Ectoderm Cultured Cells | H3K27ac_Enh | ||||||
| E013 | ES-deriv | ESDR.CD56.MESO | hESC Derived CD56+ Mesoderm Cultured Cells | H3K27ac_Enh | ||||||
| E014 | ESC | ESC.HUES48 | HUES48 Cells | |||||||
| E015 | ESC | ESC.HUES6 | HUES6 Cells | |||||||
| E016 | ESC | ESC.HUES64 | HUES64 Cells | |||||||
| E017 | IMR90 | LNG.IMR90 | IMR90 fetal lung fibroblasts Cell Line | |||||||
| E018 | iPSC | IPSC.15b | iPS-15b Cells | |||||||
| E019 | iPSC | IPSC.18 | iPS-18 Cells | |||||||
| E020 | iPSC | IPSC.20B | iPS-20b Cells | |||||||
| E021 | iPSC | IPSC.DF.6.9 | iPS DF 6.9 Cells | |||||||
| E022 | iPSC | IPSC.DF.19.11 | iPS DF 19.11 Cells | |||||||
| E023 | Mesench | FAT.MSC.DR.ADIP | Mesenchymal Stem Cell Derived Adipocyte Cultured Cells | |||||||
| E024 | ESC | ESC.4STAR | ES-UCSF4 Cells | |||||||
| E025 | Mesench | FAT.ADIP.DR.MSC | Adipose Derived Mesenchymal Stem Cell Cultured Cells | |||||||
| E026 | Mesench | STRM.MRW.MSC | Bone Marrow Derived Cultured Mesenchymal Stem Cells | |||||||
| E027 | Epithelial | BRST.MYO | Breast Myoepithelial Primary Cells | H3K4me1_Enh | ||||||
| E028 | Epithelial | BRST.HMEC.35 | Breast variant Human Mammary Epithelial Cells (vHMEC) | |||||||
| E029 | HSC & B-cell | BLD.CD14.PC | Primary monocytes from peripheral blood | |||||||
| E030 | HSC & B-cell | BLD.CD15.PC | Primary neutrophils from peripheral blood | |||||||
| E031 | HSC & B-cell | BLD.CD19.CPC | Primary B cells from cord blood | |||||||
| E032 | HSC & B-cell | BLD.CD19.PPC | Primary B cells from peripheral blood | |||||||
| E033 | Blood & T-cell | BLD.CD3.CPC | Primary T cells from cord blood | |||||||
| E034 | Blood & T-cell | BLD.CD3.PPC | Primary T cells from peripheral blood | |||||||
| E035 | HSC & B-cell | BLD.CD34.PC | Primary hematopoietic stem cells | |||||||
| E036 | HSC & B-cell | BLD.CD34.CC | Primary hematopoietic stem cells short term culture | |||||||
| E037 | Blood & T-cell | BLD.CD4.MPC | Primary T helper memory cells from peripheral blood 2 | |||||||
| E038 | Blood & T-cell | BLD.CD4.NPC | Primary T helper naive cells from peripheral blood | |||||||
| E039 | Blood & T-cell | BLD.CD4.CD25M.CD45RA.NPC | Primary T helper naive cells from peripheral blood | |||||||
| E040 | Blood & T-cell | BLD.CD4.CD25M.CD45RO.MPC | Primary T helper memory cells from peripheral blood 1 | |||||||
| E041 | Blood & T-cell | BLD.CD4.CD25M.IL17M.PL.TPC | Primary T helper cells PMA-I stimulated | H3K27ac_Enh | ||||||
| E042 | Blood & T-cell | BLD.CD4.CD25M.IL17P.PL.TPC | Primary T helper 17 cells PMA-I stimulated | |||||||
| E043 | Blood & T-cell | BLD.CD4.CD25M.TPC | Primary T helper cells from peripheral blood | |||||||
| E044 | Blood & T-cell | BLD.CD4.CD25.CD127M.TREGPC | Primary T regulatory cells from peripheral blood | |||||||
| E045 | Blood & T-cell | BLD.CD4.CD25I.CD127.TMEMPC | Primary T cells effector/memory enriched from peripheral blood | |||||||
| E046 | HSC & B-cell | BLD.CD56.PC | Primary Natural Killer cells from peripheral blood | |||||||
| E047 | Blood & T-cell | BLD.CD8.NPC | Primary T CD8+ naive cells from peripheral blood | |||||||
| E048 | Blood & T-cell | BLD.CD8.MPC | Primary T CD8+ memory cells from peripheral blood | |||||||
| E049 | Mesench | STRM.CHON.MRW.DR.MSC | Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells | |||||||
| E050 | HSC & B-cell | BLD.MOB.CD34.PC.F | Primary hematopoietic stem cells G-CSF-mobilized Female | H3K27ac_Enh | ||||||
| E051 | HSC & B-cell | BLD.MOB.CD34.PC.M | Primary hematopoietic stem cells G-CSF-mobilized Male | |||||||
| E052 | Myosat | MUS.SAT | Muscle Satellite Cultured Cells | |||||||
| E053 | Neurosph | BRN.CRTX.DR.NRSPHR | Cortex derived primary cultured neurospheres | |||||||
| E054 | Neurosph | BRN.GANGEM.DR.NRSPHR | Ganglion Eminence derived primary cultured neurospheres | |||||||
| E055 | Epithelial | SKIN.PEN.FRSK.FIB.01 | Foreskin Fibroblast Primary Cells skin01 | |||||||
| E056 | Epithelial | SKIN.PEN.FRSK.FIB.02 | Foreskin Fibroblast Primary Cells skin02 | H3K4me3_Pro | H3K27ac_Enh | |||||
| E057 | Epithelial | SKIN.PEN.FRSK.KER.02 | Foreskin Keratinocyte Primary Cells skin02 | |||||||
| E058 | Epithelial | SKIN.PEN.FRSK.KER.03 | Foreskin Keratinocyte Primary Cells skin03 | |||||||
| E059 | Epithelial | SKIN.PEN.FRSK.MEL.01 | Foreskin Melanocyte Primary Cells skin01 | |||||||
| E061 | Epithelial | SKIN.PEN.FRSK.MEL.03 | Foreskin Melanocyte Primary Cells skin03 | |||||||
| E062 | Blood & T-cell | BLD.PER.MONUC.PC | Primary mononuclear cells from peripheral blood | |||||||
| E063 | Adipose | FAT.ADIP.NUC | Adipose Nuclei | |||||||
| E065 | Heart | VAS.AOR | Aorta | H3K27ac_Enh | ||||||
| E066 | Other | LIV.ADLT | Liver | |||||||
| E067 | Brain | BRN.ANG.GYR | Brain Angular Gyrus | H3K27ac_Enh | H3K9ac_Pro | |||||
| E068 | Brain | BRN.ANT.CAUD | Brain Anterior Caudate | |||||||
| E069 | Brain | BRN.CING.GYR | Brain Cingulate Gyrus | H3K4me1_Enh | H3K27ac_Enh | |||||
| E070 | Brain | BRN.GRM.MTRX | Brain Germinal Matrix | |||||||
| E071 | Brain | BRN.HIPP.MID | Brain Hippocampus Middle | H3K4me1_Enh | H3K27ac_Enh | |||||
| E072 | Brain | BRN.INF.TMP | Brain Inferior Temporal Lobe | H3K4me1_Enh | H3K27ac_Enh | |||||
| E073 | Brain | BRN.DL.PRFRNTL.CRTX | Brain_Dorsolateral_Prefrontal_Cortex | H3K4me1_Enh | H3K27ac_Enh | |||||
| E074 | Brain | BRN.SUB.NIG | Brain Substantia Nigra | |||||||
| E075 | Digestive | GI.CLN.MUC | Colonic Mucosa | |||||||
| E076 | Sm. Muscle | GI.CLN.SM.MUS | Colon Smooth Muscle | H3K27ac_Enh | ||||||
| E077 | Digestive | GI.DUO.MUC | Duodenum Mucosa | |||||||
| E078 | Sm. Muscle | GI.DUO.SM.MUS | Duodenum Smooth Muscle | |||||||
| E079 | Digestive | GI.ESO | Esophagus | H3K27ac_Enh | ||||||
| E080 | Other | ADRL.GLND.FET | Fetal Adrenal Gland | |||||||
| E081 | Brain | BRN.FET.M | Fetal Brain Male | |||||||
| E082 | Brain | BRN.FET.F | Fetal Brain Female | H3K4me1_Enh | ||||||
| E083 | Heart | HRT.FET | Fetal Heart | |||||||
| E084 | Digestive | GI.L.INT.FET | Fetal Intestine Large | |||||||
| E085 | Digestive | GI.S.INT.FET | Fetal Intestine Small | |||||||
| E086 | Other | KID.FET | Fetal Kidney | |||||||
| E087 | Other | PANC.ISLT | Pancreatic Islets | |||||||
| E088 | Other | LNG.FET | Fetal Lung | |||||||
| E089 | Muscle | MUS.TRNK.FET | Fetal Muscle Trunk | H3K4me1_Enh | ||||||
| E090 | Muscle | MUS.LEG.FET | Fetal Muscle Leg | 6_EnhG | H3K4me1_Enh | H3K27ac_Enh | ||||
| E091 | Other | PLCNT.FET | Placenta | |||||||
| E092 | Digestive | GI.STMC.FET | Fetal Stomach | |||||||
| E093 | Thymus | THYM.FET | Fetal Thymus | |||||||
| E094 | Digestive | GI.STMC.GAST | Gastric | |||||||
| E095 | Heart | HRT.VENT.L | Left Ventricle | H3K4me1_Enh | ||||||
| E096 | Other | LNG | Lung | 6_EnhG | H3K4me1_Enh | |||||
| E097 | Other | OVRY | Ovary | H3K27ac_Enh | ||||||
| E098 | Other | PANC | Pancreas | |||||||
| E099 | Other | PLCNT.AMN | Placenta Amnion | |||||||
| E100 | Muscle | MUS.PSOAS | Psoas Muscle | H3K4me1_Enh | ||||||
| E101 | Digestive | GI.RECT.MUC.29 | Rectal Mucosa Donor 29 | |||||||
| E102 | Digestive | GI.RECT.MUC.31 | Rectal Mucosa Donor 31 | |||||||
| E103 | Sm. Muscle | GI.RECT.SM.MUS | Rectal Smooth Muscle | |||||||
| E104 | Heart | HRT.ATR.R | Right Atrium | H3K4me1_Enh | ||||||
| E105 | Heart | HRT.VNT.R | Right Ventricle | H3K4me1_Enh | H3K27ac_Enh | |||||
| E106 | Digestive | GI.CLN.SIG | Sigmoid Colon | |||||||
| E107 | Muscle | MUS.SKLT.M | Skeletal Muscle Male | |||||||
| E108 | Muscle | MUS.SKLT.F | Skeletal Muscle Female | |||||||
| E109 | Digestive | GI.S.INT | Small Intestine | |||||||
| E110 | Digestive | GI.STMC.MUC | Stomach Mucosa | |||||||
| E111 | Sm. Muscle | GI.STMC.MUS | Stomach Smooth Muscle | |||||||
| E112 | Thymus | THYM | Thymus | |||||||
| E113 | Other | SPLN | Spleen | |||||||
| E114 | ENCODE2012 | LNG.A549.ETOH002.CNCR | A549 EtOH 0.02pct Lung Carcinoma Cell Line | |||||||
| E115 | ENCODE2012 | BLD.DND41.CNCR | Dnd41 TCell Leukemia Cell Line | |||||||
| E116 | ENCODE2012 | BLD.GM12878 | GM12878 Lymphoblastoid Cells | |||||||
| E117 | ENCODE2012 | CRVX.HELAS3.CNCR | HeLa-S3 Cervical Carcinoma Cell Line | |||||||
| E118 | ENCODE2012 | LIV.HEPG2.CNCR | HepG2 Hepatocellular Carcinoma Cell Line | |||||||
| E119 | ENCODE2012 | BRST.HMEC | HMEC Mammary Epithelial Primary Cells | |||||||
| E120 | ENCODE2012 | MUS.HSMM | HSMM Skeletal Muscle Myoblasts Cells | |||||||
| E121 | ENCODE2012 | MUS.HSMMT | HSMM cell derived Skeletal Muscle Myotubes Cells | |||||||
| E122 | ENCODE2012 | VAS.HUVEC | HUVEC Umbilical Vein Endothelial Primary Cells | |||||||
| E123 | ENCODE2012 | BLD.K562.CNCR | K562 Leukemia Cells | |||||||
| E124 | ENCODE2012 | BLD.CD14.MONO | Monocytes-CD14+ RO01746 Primary Cells | H3K27ac_Enh | ||||||
| E125 | ENCODE2012 | BRN.NHA | NH-A Astrocytes Primary Cells | |||||||
| E126 | ENCODE2012 | SKIN.NHDFAD | NHDF-Ad Adult Dermal Fibroblast Primary Cells | |||||||
| E127 | ENCODE2012 | SKIN.NHEK | NHEK-Epidermal Keratinocyte Primary Cells | |||||||
| E128 | ENCODE2012 | LNG.NHLF | NHLF Lung Fibroblast Primary Cells | |||||||
| E129 | ENCODE2012 | BONE.OSTEO | Osteoblast Primary Cells | H3K27ac_Enh |
Hits from selected eQTL studies
| Study ID | Paper Title | PMID | Tissue | Correlated gene | p-value |
| GTEx2015_v6 | The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans | 25954001 | Testis | LACTBL1 | 4.44821468452311e-11 |
| Westra2013 | Systematic identification of trans eQTLs as putative drivers of known disease associations | 24013639 | Whole_Blood | LUZP1 | 0.00255458298005232 |
Regulatory motifs altered
| Position Weight Matrix ID (Library from Kheradpour and Kellis, 2013) | Strand | Ref | Alt | Match on:Ref: TATAGCACCAGAATCCAGGGCTCCAACACTCAAAGACAAGAATTATTGGCGAGATCTTT |
| Foxp1 | - | -16.7 | -27.2 | AWAMWMRMMAAYAYAAATAA |
| GLI | - | -0 | 11.9 | VGACCACCMAVD |